pycom03g07610

Metallothionein-like protein type 2

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0000858
Physical Location & Seq
Reverse (-)
6049690 .. 6050233
544 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g07610.1

Sequence Viewer

Length: 228 bp
ATGTCTTGCAATTGTAGCTGTGGCAGTGACTGCAAGTGCGGCAGTGGCTGCAAGTGTGGCATGTACCCTGACTTGAGCTACTCAGAGACCACTTCCACTGAAACTATCATTGCCGGAGTTGCACCTATGAAGATGTTCTCTGAGGGGTCTGAGATGAGCTATGGAGCAGAGAATGACTGCAAGTGTGGCTCAAGCTGCAGCTGCAGCTCATGTGGCTGCCACAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallothio_2

Protein Analysis

76

Amino Acids

7.72

Weight (kDa)

4.79

Isoelectric Point (pI)

73.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Metallothio_2 PF01439 3 - 73 3.3e-20 Metallothionein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 39
AfaI GTAC 1 cut(s) 65
AluBI AGCT 6 cut(s) 18, 78, 159, 195, 201, 207
AluI AGCT 6 cut(s) 18, 78, 159, 195, 201, 207
Alw26I GTCTC 1 cut(s) 80
AlwNI CAGNNNCTG 2 cut(s) 30, 48
ApeKI GCWGC 6 cut(s) 48, 195, 198, 201, 204, 216
Asp700I GAANNNNTTC 1 cut(s) 134
BbvI GCAGC 6 cut(s) 35, 182, 188, 203, 210, 216
BcoDI GTCTC 1 cut(s) 80
BfmI CTRYAG 2 cut(s) 196, 202
BisI GCNGC 7 cut(s) 40, 49, 196, 199, 202, 205, 217
BlsI GCNGC 7 cut(s) 41, 50, 197, 200, 203, 206, 218
BpuEI CTTGAG 2 cut(s) 94, 175
BsaI GGTCTC 1 cut(s) 80
Bse3DI GCAATG 1 cut(s) 108
BseMI GCAATG 1 cut(s) 108
BseMII CTCAG 3 cut(s) 96, 132, 141
BseXI GCAGC 6 cut(s) 35, 182, 188, 203, 210, 216
BsiSI CCGG 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 80
Bso31I GGTCTC 1 cut(s) 80
BspACI CCGC 1 cut(s) 39
BspCNI CTCAG 3 cut(s) 95, 133, 142
BspMAI CTGCAG 2 cut(s) 200, 206
BspTNI GGTCTC 1 cut(s) 80
BsrDI GCAATG 1 cut(s) 108
BstAPI GCANNNNNTGC 2 cut(s) 30, 48
BstDEI CTNAG 3 cut(s) 82, 141, 150
BstMAI GTCTC 1 cut(s) 80
BstNSI RCATGY 1 cut(s) 64
BstSFI CTRYAG 2 cut(s) 196, 202
BstV1I GCAGC 6 cut(s) 35, 182, 188, 203, 210, 216
BtsI GCAGTG 2 cut(s) 31, 49
BtsIMutI CAGTG 3 cut(s) 31, 49, 96
CaiI CAGNNNCTG 2 cut(s) 30, 48
Csp6I GTAC 1 cut(s) 64
CviAII CATG 2 cut(s) 61, 210
CviJI RGCY 9 cut(s) 18, 48, 78, 159, 189, 195, 201, 207, 216
CviKI_1 RGCY 9 cut(s) 18, 48, 78, 159, 189, 195, 201, 207, 216
CviQI GTAC 1 cut(s) 64
DdeI CTNAG 3 cut(s) 82, 141, 150
Eco31I GGTCTC 1 cut(s) 80
FaeI CATG 2 cut(s) 64, 213
FaiI YATR 4 cut(s) 62, 128, 162, 211
FatI CATG 2 cut(s) 60, 209
Fnu4HI GCNGC 7 cut(s) 40, 49, 196, 199, 202, 205, 217
Fsp4HI GCNGC 7 cut(s) 40, 49, 196, 199, 202, 205, 217
GluI GCNGC 7 cut(s) 40, 49, 196, 199, 202, 205, 217
HapII CCGG 1 cut(s) 114
Hin1II CATG 2 cut(s) 64, 213
HpaII CCGG 1 cut(s) 114
Hpy188I TCNGA 3 cut(s) 85, 142, 151
HpyCH4V TGCA 7 cut(s) 9, 33, 51, 122, 180, 198, 204
HpyF3I CTNAG 3 cut(s) 82, 141, 150
Hsp92II CATG 2 cut(s) 64, 213
LmnI GCTCC 1 cut(s) 164
LpnPI CCDG 2 cut(s) 81, 127
Lsp1109I GCAGC 6 cut(s) 35, 182, 188, 203, 210, 216
MaeIII GTNAC 1 cut(s) 26
MboII GAAGA 1 cut(s) 142
MfeI CAATTG 1 cut(s) 10
MluCI AATT 1 cut(s) 10
MnlI CCTC 1 cut(s) 136
MroXI GAANNNNTTC 1 cut(s) 134
MspA1I CMGCKG 1 cut(s) 201
MspI CCGG 1 cut(s) 114
MunI CAATTG 1 cut(s) 10
NlaIII CATG 2 cut(s) 64, 213
NmuCI GTSAC 1 cut(s) 26
NspI RCATGY 1 cut(s) 64
PdmI GAANNNNTTC 1 cut(s) 134
PkrI GCNGC 7 cut(s) 41, 50, 197, 200, 203, 206, 218
PstI CTGCAG 2 cut(s) 200, 206
PstNI CAGNNNCTG 2 cut(s) 30, 48
PvuII CAGCTG 1 cut(s) 201
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
SatI GCNGC 7 cut(s) 40, 49, 196, 199, 202, 205, 217
SetI ASST 7 cut(s) 20, 80, 127, 161, 197, 203, 209
SfcI CTRYAG 2 cut(s) 196, 202
SmlI CTYRAG 2 cut(s) 73, 190
SmoI CTYRAG 2 cut(s) 73, 190
Sse9I AATT 1 cut(s) 10
SsiI CCGC 1 cut(s) 39
TasI AATT 1 cut(s) 10
TauI GCSGC 1 cut(s) 42
TscAI CASTG 3 cut(s) 31, 49, 103
TseFI GTSAC 1 cut(s) 26
TseI GCWGC 6 cut(s) 48, 195, 198, 201, 204, 216
Tsp45I GTSAC 1 cut(s) 26
TspDTI ATGAA 1 cut(s) 143
TspRI CASTG 3 cut(s) 31, 49, 103
XceI RCATGY 1 cut(s) 64
XmnI GAANNNNTTC 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.