Rmu_sc0040279.1_g000001

metallothionein-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040279.1
Physical Location & Seq
Forward (+)
248 .. 878
631 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040279.1_g000001.1.cds

Sequence Viewer

Length: 231 bp
atgccttgcggaaacccaaactgctcgtgctccaactgctcctgcggcgacgactgcaactgcggaaggactggcttgagtttctcagagaacgccaccacctctaagatcatcattgatggggttgcaccgctaaagacgtactatgaggattcagaaatgaattttggagaggtatacgtccagcgcaagtttggctcaaactgtgattcattcggctttcacaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

8.25

Weight (kDa)

4.79

Isoelectric Point (pI)

34.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 177
AciI CCGC 4 cut(s) 9, 45, 63, 131
AcsI RAATTY 1 cut(s) 163
AfaI GTAC 1 cut(s) 143
AjuI GAANNNNNNNTTGG 2 cut(s) 150, 182
Alw21I GWGCWC 1 cut(s) 32
ApoI RAATTY 1 cut(s) 163
AspLEI GCGC 1 cut(s) 189
BauI CACGAG 1 cut(s) 25
Bbv12I GWGCWC 1 cut(s) 32
BccI CCATC 1 cut(s) 113
BisI GCNGC 1 cut(s) 46
BlsI GCNGC 1 cut(s) 47
BpuEI CTTGAG 1 cut(s) 97
Bse1I ACTGG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 99
BseNI ACTGG 1 cut(s) 76
BsiHKAI GWGCWC 1 cut(s) 32
Bsp1286I GDGCHC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 108
BspACI CCGC 4 cut(s) 9, 45, 63, 131
BspCNI CTCAG 1 cut(s) 98
BsrI ACTGG 1 cut(s) 76
BssMI GATC 1 cut(s) 108
BssNAI GTATAC 1 cut(s) 178
BssSI CACGAG 1 cut(s) 25
Bst1107I GTATAC 1 cut(s) 178
Bst2BI CACGAG 1 cut(s) 25
Bst4CI ACNGT 1 cut(s) 206
BstDEI CTNAG 2 cut(s) 85, 105
BstHHI GCGC 1 cut(s) 189
BstKTI GATC 1 cut(s) 111
BstMBI GATC 1 cut(s) 108
BstMWI GCNNNNNNNGC 4 cut(s) 36, 45, 54, 195
BstZ17I GTATAC 1 cut(s) 178
CfoI GCGC 1 cut(s) 189
Csp6I GTAC 1 cut(s) 142
CviJI RGCY 3 cut(s) 75, 198, 219
CviKI_1 RGCY 3 cut(s) 75, 198, 219
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 2 cut(s) 85, 105
DpnI GATC 1 cut(s) 110
DpnII GATC 1 cut(s) 108
FaiI YATR 2 cut(s) 147, 178
FblI GTMKAC 1 cut(s) 177
Fnu4HI GCNGC 1 cut(s) 46
Fsp4HI GCNGC 1 cut(s) 46
GlaI GCGC 1 cut(s) 188
GluI GCNGC 1 cut(s) 46
HhaI GCGC 1 cut(s) 189
Hin6I GCGC 1 cut(s) 187
HinP1I GCGC 1 cut(s) 187
HinfI GANTC 2 cut(s) 152, 209
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 2 cut(s) 88, 157
Hpy8I GTNNAC 1 cut(s) 178
Hpy99I CGWCG 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 60
HpyCH4III ACNGT 1 cut(s) 206
HpyCH4IV ACGT 2 cut(s) 140, 180
HpyCH4V TGCA 2 cut(s) 57, 128
HpyF10VI GCNNNNNNNGC 4 cut(s) 36, 45, 54, 195
HpyF3I CTNAG 2 cut(s) 85, 105
HpySE526I ACGT 2 cut(s) 140, 180
HspAI GCGC 1 cut(s) 187
Kzo9I GATC 1 cut(s) 108
LmnI GCTCC 2 cut(s) 35, 44
LpnPI CCDG 3 cut(s) 55, 57, 197
MaeII ACGT 2 cut(s) 140, 180
MalI GATC 1 cut(s) 110
MboI GATC 1 cut(s) 108
MhlI GDGCHC 1 cut(s) 32
MluCI AATT 1 cut(s) 163
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 3 cut(s) 112, 142, 166
MwoI GCNNNNNNNGC 4 cut(s) 36, 45, 54, 195
NdeII GATC 1 cut(s) 108
PfeI GAWTC 2 cut(s) 152, 209
PkrI GCNGC 1 cut(s) 47
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SatI GCNGC 1 cut(s) 46
Sau3AI GATC 1 cut(s) 108
SduI GDGCHC 1 cut(s) 32
SetI ASST 4 cut(s) 104, 143, 177, 183
SgeI CNNG 8 cut(s) 18, 37, 39, 54, 84, 88, 196, 202
SmlI CTYRAG 1 cut(s) 76
SmoI CTYRAG 1 cut(s) 76
Sse9I AATT 1 cut(s) 163
SsiI CCGC 4 cut(s) 9, 45, 63, 131
TaaI ACNGT 1 cut(s) 206
TaiI ACGT 2 cut(s) 143, 183
TasI AATT 1 cut(s) 163
TauI GCSGC 1 cut(s) 48
TfiI GAWTC 2 cut(s) 152, 209
TspDTI ATGAA 2 cut(s) 176, 201
XapI RAATTY 1 cut(s) 163
XcmI CCANNNNNNNNNTGG 1 cut(s) 191
XmiI GTMKAC 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.