Rh5AG423500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
OG0000858
Physical Location & Seq
Forward (+)
73059080 .. 73060426
1347 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG423500.1

Sequence Viewer

Length: 183 bp
ATGCCTTGCGGAAACCCAAACTGCTCGTGCTCCAACTGCTCCTGCGGCGACGACTGCAACTGCGGAAGGACTGGCTTGAGTTTCTCAGAGAACACCACCACCTCTAAGATCATCATTGATGGGGTTGCACCGCTAAAGACGTACGCTATCTCCTGCTCAATTCTTTCTGGGTGCATTACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

6.13

Weight (kDa)

4.68

Isoelectric Point (pI)

36.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 9, 45, 63, 131
AfaI GTAC 1 cut(s) 143
Alw21I GWGCWC 1 cut(s) 32
BauI CACGAG 1 cut(s) 25
Bbv12I GWGCWC 1 cut(s) 32
BccI CCATC 1 cut(s) 113
BisI GCNGC 1 cut(s) 46
BlsI GCNGC 1 cut(s) 47
BpuEI CTTGAG 1 cut(s) 97
BsaXI ACNNNNNCTCC 2 cut(s) 134, 164
Bse1I ACTGG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 99
BseNI ACTGG 1 cut(s) 76
BsiHKAI GWGCWC 1 cut(s) 32
BsiWI CGTACG 1 cut(s) 141
Bsp1286I GDGCHC 1 cut(s) 32
Bsp143I GATC 1 cut(s) 108
BspACI CCGC 4 cut(s) 9, 45, 63, 131
BspCNI CTCAG 1 cut(s) 98
BsrI ACTGG 1 cut(s) 76
BssMI GATC 1 cut(s) 108
BssSI CACGAG 1 cut(s) 25
Bst2BI CACGAG 1 cut(s) 25
BstDEI CTNAG 2 cut(s) 85, 105
BstKTI GATC 1 cut(s) 111
BstMBI GATC 1 cut(s) 108
BstMWI GCNNNNNNNGC 3 cut(s) 36, 45, 54
Csp6I GTAC 1 cut(s) 142
CviJI RGCY 1 cut(s) 75
CviKI_1 RGCY 1 cut(s) 75
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 2 cut(s) 85, 105
DpnI GATC 1 cut(s) 110
DpnII GATC 1 cut(s) 108
Fnu4HI GCNGC 1 cut(s) 46
Fsp4HI GCNGC 1 cut(s) 46
GluI GCNGC 1 cut(s) 46
Hpy188I TCNGA 1 cut(s) 88
Hpy99I CGWCG 1 cut(s) 53
HpyAV CCTTC 1 cut(s) 60
HpyCH4IV ACGT 1 cut(s) 140
HpyCH4V TGCA 3 cut(s) 57, 128, 174
HpyF10VI GCNNNNNNNGC 3 cut(s) 36, 45, 54
HpyF3I CTNAG 2 cut(s) 85, 105
HpySE526I ACGT 1 cut(s) 140
Kzo9I GATC 1 cut(s) 108
LmnI GCTCC 2 cut(s) 35, 44
LpnPI CCDG 4 cut(s) 55, 57, 153, 166
MaeII ACGT 1 cut(s) 140
MalI GATC 1 cut(s) 110
MboI GATC 1 cut(s) 108
MhlI GDGCHC 1 cut(s) 32
MluCI AATT 1 cut(s) 159
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 1 cut(s) 112
MwoI GCNNNNNNNGC 3 cut(s) 36, 45, 54
NdeII GATC 1 cut(s) 108
Pfl23II CGTACG 1 cut(s) 141
PkrI GCNGC 1 cut(s) 47
PspLI CGTACG 1 cut(s) 141
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SatI GCNGC 1 cut(s) 46
Sau3AI GATC 1 cut(s) 108
SduI GDGCHC 1 cut(s) 32
SetI ASST 3 cut(s) 104, 143, 182
SgeI CNNG 7 cut(s) 18, 37, 39, 54, 84, 88, 165
SmlI CTYRAG 1 cut(s) 76
SmoI CTYRAG 1 cut(s) 76
Sse9I AATT 1 cut(s) 159
SsiI CCGC 4 cut(s) 9, 45, 63, 131
TaiI ACGT 1 cut(s) 143
TasI AATT 1 cut(s) 159
TauI GCSGC 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.