Rmu_sc0001125.1_g000004

Metallothionein-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001125.1
Physical Location & Seq
Reverse (-)
7613 .. 8113
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001125.1_g000004.1.cds

Sequence Viewer

Length: 231 bp
atgtctgggtgtggatcaacaagctgcaaatgcggttctagctgcaaatgcggctctagctgcaactgtggaaactaccctgatcttgagagcagcacaacagcaaccatcattgctggggttccatcaaccaacatgtactttgaggagtcagagatgagcttcggtgctgaaaatggctgcaagtgcggccaaagctgcagctgcacctcatgcggctgccacaagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

76

Amino Acids

7.7

Weight (kDa)

5.05

Isoelectric Point (pI)

86.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 33, 51, 189, 216
AclWI GGATC 1 cut(s) 22
AcoI YGGCCR 1 cut(s) 190
AfaI GTAC 1 cut(s) 140
AflIII ACRYGT 1 cut(s) 135
AluBI AGCT 6 cut(s) 24, 42, 60, 162, 198, 204
AluI AGCT 6 cut(s) 24, 42, 60, 162, 198, 204
AlwI GGATC 1 cut(s) 22
AoxI GGCC 1 cut(s) 190
ApeKI GCWGC 9 cut(s) 24, 42, 60, 93, 180, 198, 201, 204, 219
BbvI GCAGC 9 cut(s) 11, 29, 47, 105, 167, 185, 191, 206, 213
BccI CCATC 2 cut(s) 116, 133
BfaI CTAG 2 cut(s) 39, 57
BfmI CTRYAG 1 cut(s) 199
BmiI GGNNCC 1 cut(s) 123
BpuEI CTTGAG 1 cut(s) 107
Bse3DI GCAATG 1 cut(s) 111
BseMI GCAATG 1 cut(s) 111
BseRI GAGGAG 1 cut(s) 161
BseXI GCAGC 9 cut(s) 11, 29, 47, 105, 167, 185, 191, 206, 213
BseYI CCCAGC 1 cut(s) 116
BsgI GTGCAG 1 cut(s) 190
BshFI GGCC 1 cut(s) 192
BsnI GGCC 1 cut(s) 192
Bsp143I GATC 2 cut(s) 14, 82
BspACI CCGC 4 cut(s) 33, 51, 189, 216
BspANI GGCC 1 cut(s) 192
BspLI GGNNCC 1 cut(s) 123
BspMAI CTGCAG 1 cut(s) 203
BspPI GGATC 1 cut(s) 22
BsrDI GCAATG 1 cut(s) 111
BssMI GATC 2 cut(s) 14, 82
Bst4CI ACNGT 1 cut(s) 68
BstAPI GCANNNNNTGC 1 cut(s) 213
BstKTI GATC 2 cut(s) 17, 85
BstMBI GATC 2 cut(s) 14, 82
BstNSI RCATGY 1 cut(s) 139
BstSFI CTRYAG 1 cut(s) 199
BstV1I GCAGC 9 cut(s) 11, 29, 47, 105, 167, 185, 191, 206, 213
BsuRI GGCC 1 cut(s) 192
Csp6I GTAC 1 cut(s) 139
CviAII CATG 2 cut(s) 136, 213
CviQI GTAC 1 cut(s) 139
DpnI GATC 2 cut(s) 16, 84
DpnII GATC 2 cut(s) 14, 82
EaeI YGGCCR 1 cut(s) 190
FaeI CATG 2 cut(s) 139, 216
FaiI YATR 2 cut(s) 137, 214
FatI CATG 2 cut(s) 135, 212
FspBI CTAG 2 cut(s) 39, 57
GsaI CCCAGC 1 cut(s) 120
HaeIII GGCC 1 cut(s) 192
Hin1II CATG 2 cut(s) 139, 216
HinfI GANTC 1 cut(s) 149
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 86
HpyCH4III ACNGT 1 cut(s) 68
HpyCH4V TGCA 6 cut(s) 27, 45, 63, 183, 201, 207
Hsp92II CATG 2 cut(s) 139, 216
Kzo9I GATC 2 cut(s) 14, 82
LpnPI CCDG 2 cut(s) 93, 102
Lsp1109I GCAGC 9 cut(s) 11, 29, 47, 105, 167, 185, 191, 206, 213
MaeI CTAG 2 cut(s) 39, 57
MalI GATC 2 cut(s) 16, 84
MboI GATC 2 cut(s) 14, 82
MlyI GAGTC 1 cut(s) 158
MnlI CCTC 2 cut(s) 139, 220
MspA1I CMGCKG 1 cut(s) 204
NdeII GATC 2 cut(s) 14, 82
NlaIII CATG 2 cut(s) 139, 216
NlaIV GGNNCC 1 cut(s) 123
NspI RCATGY 1 cut(s) 139
PciI ACATGT 1 cut(s) 135
PleI GAGTC 1 cut(s) 157
PpsI GAGTC 1 cut(s) 157
PscI ACATGT 1 cut(s) 135
PspFI CCCAGC 1 cut(s) 116
PspN4I GGNNCC 1 cut(s) 123
PstI CTGCAG 1 cut(s) 203
PvuII CAGCTG 1 cut(s) 204
RsaI GTAC 1 cut(s) 140
RsaNI GTAC 1 cut(s) 139
Sau3AI GATC 2 cut(s) 14, 82
SchI GAGTC 1 cut(s) 158
SetI ASST 7 cut(s) 26, 44, 62, 164, 200, 206, 212
SfcI CTRYAG 1 cut(s) 199
SmlI CTYRAG 1 cut(s) 86
SmoI CTYRAG 1 cut(s) 86
SsiI CCGC 4 cut(s) 33, 51, 189, 216
SspMI CTAG 2 cut(s) 39, 57
TaaI ACNGT 1 cut(s) 68
TatI WGTACW 1 cut(s) 138
TauI GCSGC 3 cut(s) 54, 192, 219
TseI GCWGC 9 cut(s) 24, 42, 60, 93, 180, 198, 201, 204, 219
XceI RCATGY 1 cut(s) 139
XspI CTAG 2 cut(s) 39, 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.