Rmu_sc0006937.1_g000003

Metallothionein-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006937.1
OG0000858
Physical Location & Seq
Reverse (-)
4403 .. 4918
516 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006937.1_g000003.1.cds

Sequence Viewer

Length: 219 bp
atgtcttcaggctgcaagtgtggctcaaactgcagctgcggctcggactgcaaatgtggcagcatgtaccctgacttggagaacaccacaactgagaccataattgctggagttgcaccagtcaagaccggctactatgaagggtctgagtatggagcagagaatggctgcaagtgcggcagcagctgcagctgcgactcatgcggctgtggcaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Metallothio_2

Protein Analysis

72

Amino Acids

7.24

Weight (kDa)

4.55

Isoelectric Point (pI)

50.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 39, 177, 204
AfaI GTAC 1 cut(s) 68
AfiI CCNNNNNNNGG 1 cut(s) 76
AluBI AGCT 3 cut(s) 36, 186, 192
AluI AGCT 3 cut(s) 36, 186, 192
Alw26I GTCTC 1 cut(s) 89
AlwNI CAGNNNCTG 1 cut(s) 186
BbvI GCAGC 9 cut(s) 23, 45, 72, 155, 173, 179, 192, 195, 201
BcoDI GTCTC 1 cut(s) 89
BfmI CTRYAG 2 cut(s) 31, 187
BpmI CTGGAG 1 cut(s) 129
BsaI GGTCTC 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 76
Bse118I RCCGGY 1 cut(s) 128
Bse1I ACTGG 1 cut(s) 119
BseLI CCNNNNNNNGG 1 cut(s) 76
BseMII CTCAG 2 cut(s) 84, 138
BseNI ACTGG 1 cut(s) 119
BseXI GCAGC 9 cut(s) 23, 45, 72, 155, 173, 179, 192, 195, 201
BsiSI CCGG 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 76
BsmAI GTCTC 1 cut(s) 89
Bso31I GGTCTC 1 cut(s) 89
BspACI CCGC 3 cut(s) 39, 177, 204
BspCNI CTCAG 2 cut(s) 85, 139
BspMAI CTGCAG 2 cut(s) 35, 191
BspTNI GGTCTC 1 cut(s) 89
BsrFI RCCGGY 1 cut(s) 128
BsrI ACTGG 1 cut(s) 119
BssAI RCCGGY 1 cut(s) 128
BstAPI GCANNNNNTGC 1 cut(s) 186
BstDEI CTNAG 2 cut(s) 93, 147
BstMAI GTCTC 1 cut(s) 89
BstNSI RCATGY 1 cut(s) 67
BstSFI CTRYAG 2 cut(s) 31, 187
BstV1I GCAGC 9 cut(s) 23, 45, 72, 155, 173, 179, 192, 195, 201
CaiI CAGNNNCTG 1 cut(s) 186
Cfr10I RCCGGY 1 cut(s) 128
Csp6I GTAC 1 cut(s) 67
CviAII CATG 2 cut(s) 64, 201
CviJI RGCY 9 cut(s) 12, 24, 36, 42, 132, 168, 186, 192, 207
CviKI_1 RGCY 9 cut(s) 12, 24, 36, 42, 132, 168, 186, 192, 207
CviQI GTAC 1 cut(s) 67
DdeI CTNAG 2 cut(s) 93, 147
Eco31I GGTCTC 1 cut(s) 89
FaeI CATG 2 cut(s) 67, 204
FaiI YATR 5 cut(s) 65, 101, 138, 153, 202
FatI CATG 2 cut(s) 63, 200
GsuI CTGGAG 1 cut(s) 129
HapII CCGG 1 cut(s) 129
Hin1II CATG 2 cut(s) 67, 204
HinfI GANTC 1 cut(s) 197
HpaII CCGG 1 cut(s) 129
Hpy188I TCNGA 2 cut(s) 46, 148
Hpy188III TCNNGA 1 cut(s) 124
HpyAV CCTTC 1 cut(s) 134
HpyCH4V TGCA 6 cut(s) 15, 33, 51, 116, 171, 189
HpyF3I CTNAG 2 cut(s) 93, 147
Hsp92II CATG 2 cut(s) 67, 204
LmnI GCTCC 1 cut(s) 155
LpnPI CCDG 4 cut(s) 84, 93, 132, 142
Lsp1109I GCAGC 9 cut(s) 23, 45, 72, 155, 173, 179, 192, 195, 201
MluCI AATT 1 cut(s) 102
MlyI GAGTC 1 cut(s) 191
MspA1I CMGCKG 3 cut(s) 36, 186, 192
MspI CCGG 1 cut(s) 129
NlaIII CATG 2 cut(s) 67, 204
NspI RCATGY 1 cut(s) 67
PleI GAGTC 1 cut(s) 191
PpsI GAGTC 1 cut(s) 191
PstI CTGCAG 2 cut(s) 35, 191
PstNI CAGNNNCTG 1 cut(s) 186
PvuII CAGCTG 3 cut(s) 36, 186, 192
RsaI GTAC 1 cut(s) 68
RsaNI GTAC 1 cut(s) 67
SchI GAGTC 1 cut(s) 191
SetI ASST 3 cut(s) 38, 188, 194
SfcI CTRYAG 2 cut(s) 31, 187
Sse9I AATT 1 cut(s) 102
SsiI CCGC 3 cut(s) 39, 177, 204
TasI AATT 1 cut(s) 102
TauI GCSGC 3 cut(s) 42, 180, 207
TspDTI ATGAA 1 cut(s) 153
XceI RCATGY 1 cut(s) 67
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.