Prupe.8G117400_v2.0.a1
MYB Family

Myb/SANT-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
14427915 .. 14428907
993 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G117400.1

Sequence Viewer

Length: 720 bp
ATGGCCCCCAAGAATGTTGACGGTGAGGAAAAATTATTGCATGATCATGTGAAGAATGGTGACTTGCAAGCATCAACCTTTAAAAAGAAAGTTTGGTCCGAAATAAGCGAGGAGTTATCAGGAAAATGTGGAAAAAAATGCACTATTAAGCAACTTAAGTCTAAGTTTAATAGGTTGCGAACTGCACATGATGAGTTCTCGGATCTAATTGAGCACATTGGATTTGGGTGGGATCTTATTGCTAACACAGTCATTGCTTCAGATAATAGTAACCCAAGAGCGAAGCAATATCGCACTCAAGGTTTAGTGCACTATCAGCTTTTAGGGGAGATATTTAACACCACTACTGCAATCGATCAATTGCGTTATGCCTCTAATCAACATCCTCCTAACTCAAATAAAAACAGTGAGTTAGAGAACTACTTCCTTAACATCAGTGTTAACATTGATGTTGACTTGGATGATGATGGTGTTAACCTGGAAATTGATCATGGTAAAGGAAAAAGAAAGTCTGAAAAGAGTCTTGAAGCATCTAGCACCTCCAATGAGATGTATTATATTGAAGAATGCATCGGACTTGTTGAAGAAATTGGGGACATTGATAATGACACATTTAACAAAATGCTAGAAAAAATTGTGCTTGAAGAATGGAGGAAAATATTTGTTATAATGCCATATGCTAGGAGAAGAGCTTGGTTAGCTAGTCTTCAGGAATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

240

Amino Acids

27.44

Weight (kDa)

5.45

Isoelectric Point (pI)

51.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 668
AclWI GGATC 2 cut(s) 210, 240
AcuI CTGAAG 2 cut(s) 243, 692
AflII CTTAAG 1 cut(s) 155
AgsI TTSAA 4 cut(s) 527, 563, 584, 644
AjnI CCWGG 1 cut(s) 477
AluBI AGCT 3 cut(s) 319, 692, 701
AluI AGCT 3 cut(s) 319, 692, 701
Alw21I GWGCWC 2 cut(s) 216, 312
Alw44I GTGCAC 1 cut(s) 308
AlwI GGATC 2 cut(s) 210, 240
AoxI GGCC 1 cut(s) 3
ApaLI GTGCAC 1 cut(s) 308
Asp700I GAANNNNTTC 1 cut(s) 422
AspS9I GGNCC 2 cut(s) 4, 96
AsuHPI GGTGA 2 cut(s) 35, 71
AvaII GGWCC 1 cut(s) 96
BaeGI GKGCMC 1 cut(s) 312
BbsI GAAGAC 1 cut(s) 698
Bbv12I GWGCWC 2 cut(s) 216, 312
BccI CCATC 1 cut(s) 461
BciT130I CCWGG 1 cut(s) 479
BclI TGATCA 2 cut(s) 43, 487
BfaI CTAG 5 cut(s) 534, 626, 681, 702, 718
BfrI CTTAAG 1 cut(s) 155
Bme1390I CCNGG 1 cut(s) 479
Bme18I GGWCC 1 cut(s) 96
BmgT120I GGNCC 2 cut(s) 4, 96
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 479
BmsI GCATC 3 cut(s) 80, 539, 579
BpiI GAAGAC 1 cut(s) 698
BpuEI CTTGAG 1 cut(s) 282
Bsa29I ATCGAT 1 cut(s) 354
Bse3DI GCAATG 1 cut(s) 252
BseBI CCWGG 1 cut(s) 479
BseCI ATCGAT 1 cut(s) 354
BseGI GGATG 2 cut(s) 382, 466
BseMI GCAATG 1 cut(s) 252
BseRI GAGGAG 1 cut(s) 125
BseSI GKGCMC 1 cut(s) 312
BsgI GTGCAG 1 cut(s) 168
BshFI GGCC 1 cut(s) 5
BshVI ATCGAT 1 cut(s) 354
BsiHKAI GWGCWC 2 cut(s) 216, 312
BslFI GGGAC 1 cut(s) 608
BsmFI GGGAC 1 cut(s) 608
BsmI GAATGC 1 cut(s) 572
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 2 cut(s) 216, 312
Bsp143I GATC 5 cut(s) 43, 202, 232, 355, 487
BspANI GGCC 1 cut(s) 5
BspDI ATCGAT 1 cut(s) 354
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 2 cut(s) 210, 240
BspQI GCTCTTC 1 cut(s) 682
BspTI CTTAAG 1 cut(s) 155
BsrDI GCAATG 1 cut(s) 252
BssMI GATC 5 cut(s) 43, 202, 232, 355, 487
Bst2UI CCWGG 1 cut(s) 479
Bst4CI ACNGT 3 cut(s) 23, 250, 407
Bst6I CTCTTC 1 cut(s) 682
BstAFI CTTAAG 1 cut(s) 155
BstC8I GCNNGC 1 cut(s) 69
BstDEI CTNAG 1 cut(s) 162
BstF5I GGATG 2 cut(s) 382, 466
BstKTI GATC 5 cut(s) 46, 205, 235, 358, 490
BstMBI GATC 5 cut(s) 43, 202, 232, 355, 487
BstMWI GCNNNNNNNGC 2 cut(s) 316, 698
BstNI CCWGG 1 cut(s) 479
BstSCI CCNGG 1 cut(s) 477
BstSLI GKGCMC 1 cut(s) 312
BstV2I GAAGAC 1 cut(s) 698
BstX2I RGATCY 2 cut(s) 202, 232
BstYI RGATCY 2 cut(s) 202, 232
Bsu15I ATCGAT 1 cut(s) 354
BsuRI GGCC 1 cut(s) 5
BsuTUI ATCGAT 1 cut(s) 354
BtsCI GGATG 2 cut(s) 382, 466
BtsIMutI CAGTG 2 cut(s) 412, 442
Cac8I GCNNGC 1 cut(s) 69
Cfr13I GGNCC 2 cut(s) 4, 96
ClaI ATCGAT 1 cut(s) 354
CviAII CATG 4 cut(s) 41, 47, 188, 491
CviJI RGCY 4 cut(s) 5, 319, 692, 701
CviKI_1 RGCY 4 cut(s) 5, 319, 692, 701
DdeI CTNAG 1 cut(s) 162
DpnI GATC 5 cut(s) 45, 204, 234, 357, 489
DpnII GATC 5 cut(s) 43, 202, 232, 355, 487
DraI TTTAAA 1 cut(s) 82
Eam1104I CTCTTC 1 cut(s) 682
EarI CTCTTC 1 cut(s) 682
Eco47I GGWCC 1 cut(s) 96
Eco57I CTGAAG 2 cut(s) 243, 692
EcoRII CCWGG 1 cut(s) 477
EcoT22I ATGCAT 1 cut(s) 572
FaeI CATG 4 cut(s) 44, 50, 191, 494
FaiI YATR 9 cut(s) 42, 48, 189, 369, 492, 558, 668, 676, 678
FaqI GGGAC 1 cut(s) 608
FatI CATG 4 cut(s) 40, 46, 187, 490
FauNDI CATATG 1 cut(s) 676
FbaI TGATCA 2 cut(s) 43, 487
FokI GGATG 2 cut(s) 369, 473
FspBI CTAG 5 cut(s) 534, 626, 681, 702, 718
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 4 cut(s) 44, 50, 191, 494
HincII GTYRAC 4 cut(s) 19, 442, 454, 475
HindII GTYRAC 4 cut(s) 19, 442, 454, 475
HinfI GANTC 1 cut(s) 520
HpaI GTTAAC 2 cut(s) 442, 475
HphI GGTGA 2 cut(s) 35, 71
Hpy166II GTNNAC 5 cut(s) 19, 310, 442, 454, 475
Hpy188I TCNGA 5 cut(s) 100, 202, 262, 514, 575
Hpy188III TCNNGA 3 cut(s) 120, 524, 710
Hpy8I GTNNAC 5 cut(s) 19, 310, 442, 454, 475
HpyCH4III ACNGT 3 cut(s) 23, 250, 407
HpyCH4V TGCA 7 cut(s) 40, 67, 141, 185, 310, 350, 570
HpyF10VI GCNNNNNNNGC 2 cut(s) 316, 698
HpyF3I CTNAG 1 cut(s) 162
Hsp92II CATG 4 cut(s) 44, 50, 191, 494
Ksp22I TGATCA 2 cut(s) 43, 487
KspAI GTTAAC 2 cut(s) 442, 475
Kzo9I GATC 5 cut(s) 43, 202, 232, 355, 487
LguI GCTCTTC 1 cut(s) 682
LpnPI CCDG 4 cut(s) 105, 464, 491, 695
LweI GCATC 3 cut(s) 80, 539, 579
MaeI CTAG 5 cut(s) 534, 626, 681, 702, 718
MaeIII GTNAC 2 cut(s) 59, 269
MalI GATC 5 cut(s) 45, 204, 234, 357, 489
MboI GATC 5 cut(s) 43, 202, 232, 355, 487
MboII GAAGA 6 cut(s) 64, 575, 596, 656, 698, 699
MfeI CAATTG 1 cut(s) 359
MflI RGATCY 2 cut(s) 202, 232
MhlI GDGCHC 2 cut(s) 216, 312
MluCI AATT 6 cut(s) 32, 207, 359, 483, 588, 633
MlyI GAGTC 1 cut(s) 529
MnlI CCTC 6 cut(s) 19, 103, 382, 396, 550, 645
Mph1103I ATGCAT 1 cut(s) 572
MroXI GAANNNNTTC 1 cut(s) 422
MseI TTAA 9 cut(s) 81, 147, 156, 168, 336, 429, 441, 474, 615
MslI CAYNNNNRTG 1 cut(s) 45
MspCI CTTAAG 1 cut(s) 155
MspR9I CCNGG 1 cut(s) 479
MunI CAATTG 1 cut(s) 359
Mva1269I GAATGC 1 cut(s) 572
MvaI CCWGG 1 cut(s) 479
MwoI GCNNNNNNNGC 2 cut(s) 316, 698
NdeI CATATG 1 cut(s) 676
NdeII GATC 5 cut(s) 43, 202, 232, 355, 487
NlaIII CATG 4 cut(s) 44, 50, 191, 494
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 1 cut(s) 59
NsiI ATGCAT 1 cut(s) 572
PciSI GCTCTTC 1 cut(s) 682
PctI GAATGC 1 cut(s) 572
PdmI GAANNNNTTC 1 cut(s) 422
PleI GAGTC 1 cut(s) 528
PpsI GAGTC 1 cut(s) 528
PsiI TTATAA 1 cut(s) 668
Psp6I CCWGG 1 cut(s) 477
PspGI CCWGG 1 cut(s) 477
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 2 cut(s) 4, 96
PsuI RGATCY 2 cut(s) 202, 232
RseI CAYNNNNRTG 1 cut(s) 45
SapI GCTCTTC 1 cut(s) 682
SaqAI TTAA 9 cut(s) 81, 147, 156, 168, 336, 429, 441, 474, 615
Sau3AI GATC 5 cut(s) 43, 202, 232, 355, 487
Sau96I GGNCC 2 cut(s) 4, 96
SchI GAGTC 1 cut(s) 529
ScrFI CCNGG 1 cut(s) 479
SduI GDGCHC 2 cut(s) 216, 312
SetI ASST 8 cut(s) 80, 176, 304, 321, 480, 542, 694, 703
SfaNI GCATC 3 cut(s) 80, 539, 579
SinI GGWCC 1 cut(s) 96
SmiMI CAYNNNNRTG 1 cut(s) 45
SmlI CTYRAG 2 cut(s) 155, 297
SmoI CTYRAG 2 cut(s) 155, 297
Sse9I AATT 6 cut(s) 32, 207, 359, 483, 588, 633
SspI AATATT 1 cut(s) 660
SspMI CTAG 5 cut(s) 534, 626, 681, 702, 718
StyD4I CCNGG 1 cut(s) 477
TaaI ACNGT 3 cut(s) 23, 250, 407
TaqI TCGA 1 cut(s) 354
TasI AATT 6 cut(s) 32, 207, 359, 483, 588, 633
Tru1I TTAA 9 cut(s) 81, 147, 156, 168, 336, 429, 441, 474, 615
Tru9I TTAA 9 cut(s) 81, 147, 156, 168, 336, 429, 441, 474, 615
TscAI CASTG 2 cut(s) 412, 442
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
TspRI CASTG 2 cut(s) 412, 442
Vha464I CTTAAG 1 cut(s) 155
VneI GTGCAC 1 cut(s) 308
VpaK11BI GGWCC 1 cut(s) 96
XmnI GAANNNNTTC 1 cut(s) 422
XspI CTAG 5 cut(s) 534, 626, 681, 702, 718
Zsp2I ATGCAT 1 cut(s) 572
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.