Rh5DG120300
MYB Family

Myb/SANT-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
10875641 .. 10876030
390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG120300.1

Sequence Viewer

Length: 390 bp
ATGAAGAAATTTCGGCTTAAAGGATTGCCCCGCTATGAAACTCTAGGTGAAATATTCAACACCACTACTGCAACAGGTCAAATGCATTATGCATCTGGCCAAGTTCCACAAAACTCTGATGAGGAGCGTCAATTAGAGCATAGATTTCTAAACACTGGTGTTCACGTAAAGATTCATGATCAAGTTGATGATGTAGATGTCATTAATATTGATAGAGAATGTGATGGAGGTAAAGGAAAAAGGAAATCTACAACTGATGCCCCTTTTTCATATGATCGCAAGCCAAAGAAATGGGAAAAAATGGAGAGTTATTTGGATGTTTGTAGTGAAGTCATGGCTGAAAAATTGAAGCGCCAAAAGGACAAAAGTATTGAGGCAACTAGCATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

129

Amino Acids

14.88

Weight (kDa)

7.76

Isoelectric Point (pI)

44.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 31
AcoI YGGCCR 1 cut(s) 97
AcsI RAATTY 1 cut(s) 8
AgsI TTSAA 2 cut(s) 58, 349
AoxI GGCC 1 cut(s) 97
ApoI RAATTY 1 cut(s) 8
AseI ATTAAT 1 cut(s) 204
AspLEI GCGC 1 cut(s) 354
AsuHPI GGTGA 1 cut(s) 59
BalI TGGCCA 1 cut(s) 99
BccI CCATC 1 cut(s) 218
BclI TGATCA 1 cut(s) 178
BfaI CTAG 2 cut(s) 44, 381
BfoI RGCGCY 1 cut(s) 355
BmsI GCATC 2 cut(s) 101, 247
BsaAI YACGTR 1 cut(s) 166
Bse1I ACTGG 1 cut(s) 160
BseGI GGATG 1 cut(s) 322
BseNI ACTGG 1 cut(s) 160
BseRI GAGGAG 1 cut(s) 137
BshFI GGCC 1 cut(s) 99
BsnI GGCC 1 cut(s) 99
Bsp143I GATC 2 cut(s) 178, 274
BspACI CCGC 1 cut(s) 31
BspANI GGCC 1 cut(s) 99
BspHI TCATGA 1 cut(s) 175
BsrI ACTGG 1 cut(s) 160
BssMI GATC 2 cut(s) 178, 274
BstBAI YACGTR 1 cut(s) 166
BstC8I GCNNGC 1 cut(s) 281
BstF5I GGATG 1 cut(s) 322
BstH2I RGCGCY 1 cut(s) 355
BstHHI GCGC 1 cut(s) 354
BstKTI GATC 2 cut(s) 181, 277
BstMBI GATC 2 cut(s) 178, 274
BstXI CCANNNNNNTGG 1 cut(s) 291
BsuRI GGCC 1 cut(s) 99
BtsCI GGATG 1 cut(s) 322
BtsIMutI CAGTG 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 281
CciI TCATGA 1 cut(s) 175
CfoI GCGC 1 cut(s) 354
CseI GACGC 1 cut(s) 116
CviAII CATG 2 cut(s) 176, 334
CviJI RGCY 4 cut(s) 16, 99, 283, 338
CviKI_1 RGCY 4 cut(s) 16, 99, 283, 338
DpnI GATC 2 cut(s) 180, 276
DpnII GATC 2 cut(s) 178, 274
EaeI YGGCCR 1 cut(s) 97
EcoT22I ATGCAT 2 cut(s) 87, 94
FaeI CATG 2 cut(s) 179, 337
FaiI YATR 7 cut(s) 36, 90, 141, 177, 271, 273, 335
FatI CATG 2 cut(s) 175, 333
FauI CCCGC 1 cut(s) 38
FauNDI CATATG 1 cut(s) 271
FbaI TGATCA 1 cut(s) 178
FokI GGATG 1 cut(s) 329
FspBI CTAG 2 cut(s) 44, 381
GlaI GCGC 1 cut(s) 353
HaeII RGCGCY 1 cut(s) 355
HaeIII GGCC 1 cut(s) 99
HgaI GACGC 1 cut(s) 116
HhaI GCGC 1 cut(s) 354
Hin1II CATG 2 cut(s) 179, 337
Hin6I GCGC 1 cut(s) 352
HinP1I GCGC 1 cut(s) 352
HinfI GANTC 1 cut(s) 172
HphI GGTGA 1 cut(s) 59
Hpy166II GTNNAC 1 cut(s) 163
Hpy188I TCNGA 1 cut(s) 118
Hpy188III TCNNGA 1 cut(s) 176
Hpy8I GTNNAC 1 cut(s) 163
HpyCH4IV ACGT 1 cut(s) 165
HpyCH4V TGCA 3 cut(s) 71, 85, 92
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 2 cut(s) 179, 337
HspAI GCGC 1 cut(s) 352
Ksp22I TGATCA 1 cut(s) 178
Kzo9I GATC 2 cut(s) 178, 274
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 3 cut(s) 60, 81, 141
LweI GCATC 2 cut(s) 101, 247
MaeI CTAG 2 cut(s) 44, 381
MaeII ACGT 1 cut(s) 165
MalI GATC 2 cut(s) 180, 276
MboI GATC 2 cut(s) 178, 274
MboII GAAGA 1 cut(s) 16
MlsI TGGCCA 1 cut(s) 99
MluCI AATT 3 cut(s) 8, 131, 344
MluNI TGGCCA 1 cut(s) 99
MnlI CCTC 3 cut(s) 115, 221, 367
Mox20I TGGCCA 1 cut(s) 99
Mph1103I ATGCAT 2 cut(s) 87, 94
MscI TGGCCA 1 cut(s) 99
MseI TTAA 3 cut(s) 18, 204, 388
Msp20I TGGCCA 1 cut(s) 99
NdeI CATATG 1 cut(s) 271
NdeII GATC 2 cut(s) 178, 274
NlaIII CATG 2 cut(s) 179, 337
NsiI ATGCAT 2 cut(s) 87, 94
PagI TCATGA 1 cut(s) 175
PfeI GAWTC 1 cut(s) 172
Ppu21I YACGTR 1 cut(s) 166
PshBI ATTAAT 1 cut(s) 204
SaqAI TTAA 3 cut(s) 18, 204, 388
Sau3AI GATC 2 cut(s) 178, 274
SetI ASST 4 cut(s) 49, 79, 168, 232
SfaNI GCATC 2 cut(s) 101, 247
Sse9I AATT 3 cut(s) 8, 131, 344
SsiI CCGC 1 cut(s) 31
SspI AATATT 2 cut(s) 54, 208
SspMI CTAG 2 cut(s) 44, 381
TaiI ACGT 1 cut(s) 168
TasI AATT 3 cut(s) 8, 131, 344
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 3 cut(s) 18, 204, 388
Tru9I TTAA 3 cut(s) 18, 204, 388
TscAI CASTG 1 cut(s) 160
TspDTI ATGAA 4 cut(s) 17, 51, 164, 258
TspRI CASTG 1 cut(s) 160
VspI ATTAAT 1 cut(s) 204
XapI RAATTY 1 cut(s) 8
XspI CTAG 2 cut(s) 44, 381
Zsp2I ATGCAT 2 cut(s) 87, 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.