RLG00000008665
MYB Family

Myb/SANT-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
Physical Location & Seq
Forward (+)
34550003 .. 34550696
694 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000008665

Sequence Viewer

Length: 372 bp
ATGGCCTCTAATGAAATGGAAGTCAATGACAAAGCCGAATGGTCTGCTAAGAATGAAGGAAAATTCATTCGTATTTTGCATGAGCATAGAGTGCCAGGAGTGAAGCCATATCGTAAGAAAGGCTTGGAACATTATGAAATTTTAGGGGAAATATTTAATACTACTACTACAACAGGTCAACTGCATTATGCCTCTAGCCAACTCCCTCCCAATTCAGATGAGGAGTGCGAGTTAGAGAACAAGTTTCTTAATAATGGAGTTCACGTCAATCTTGATGATGATTTCAAGATTAACAATGCTCAAACTGAAACAAAAGGAAAAAGAAAGGCTGTGACAGAGGCTCCATCTTCAGAGCGACGCACAAAAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

14.06

Weight (kDa)

6.52

Isoelectric Point (pI)

43.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 62, 138
AcuI CTGAAG 1 cut(s) 333
AgsI TTSAA 1 cut(s) 286
AjiI CACGTC 1 cut(s) 265
AjnI CCWGG 1 cut(s) 94
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 62, 138
BccI CCATC 1 cut(s) 352
BcgI CGANNNNNNTGC 2 cut(s) 26, 60
BciT130I CCWGG 1 cut(s) 96
BfaI CTAG 1 cut(s) 195
Bme1390I CCNGG 1 cut(s) 96
BmgBI CACGTC 1 cut(s) 265
BmiI GGNNCC 1 cut(s) 342
BmrFI CCNGG 1 cut(s) 96
BsaXI ACNNNNNCTCC 6 cut(s) 215, 245, 249, 279, 325, 355
BseBI CCWGG 1 cut(s) 96
BseRI GAGGAG 1 cut(s) 236
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
BspANI GGCC 1 cut(s) 5
BspLI GGNNCC 1 cut(s) 342
Bst2UI CCWGG 1 cut(s) 96
BstAPI GCANNNNNTGC 1 cut(s) 91
BstDEI CTNAG 1 cut(s) 48
BstMWI GCNNNNNNNGC 1 cut(s) 91
BstNI CCWGG 1 cut(s) 96
BstSCI CCNGG 1 cut(s) 94
BsuRI GGCC 1 cut(s) 5
BtrI CACGTC 1 cut(s) 265
CseI GACGC 1 cut(s) 366
CviAII CATG 1 cut(s) 80
CviJI RGCY 7 cut(s) 5, 35, 106, 123, 198, 329, 341
CviKI_1 RGCY 7 cut(s) 5, 35, 106, 123, 198, 329, 341
DdeI CTNAG 1 cut(s) 48
Eco57I CTGAAG 1 cut(s) 333
EcoRII CCWGG 1 cut(s) 94
FaeI CATG 1 cut(s) 83
FaiI YATR 5 cut(s) 81, 87, 109, 135, 189
FalI AAGNNNNNCTT 2 cut(s) 107, 139
FatI CATG 1 cut(s) 79
FspBI CTAG 1 cut(s) 195
HaeIII GGCC 1 cut(s) 5
HgaI GACGC 1 cut(s) 366
Hin1II CATG 1 cut(s) 83
HincII GTYRAC 1 cut(s) 179
HindII GTYRAC 1 cut(s) 179
Hpy166II GTNNAC 2 cut(s) 179, 262
Hpy188I TCNGA 2 cut(s) 217, 352
Hpy188III TCNNGA 2 cut(s) 272, 286
Hpy8I GTNNAC 2 cut(s) 179, 262
Hpy99I CGWCG 1 cut(s) 360
HpyAV CCTTC 1 cut(s) 50
HpyCH4IV ACGT 1 cut(s) 264
HpyCH4V TGCA 2 cut(s) 79, 184
HpyF10VI GCNNNNNNNGC 1 cut(s) 91
HpyF3I CTNAG 1 cut(s) 48
HpySE526I ACGT 1 cut(s) 264
Hsp92II CATG 1 cut(s) 83
LmnI GCTCC 1 cut(s) 346
LpnPI CCDG 3 cut(s) 81, 108, 159
MaeI CTAG 1 cut(s) 195
MaeII ACGT 1 cut(s) 264
MaeIII GTNAC 1 cut(s) 331
MboII GAAGA 1 cut(s) 339
MluCI AATT 3 cut(s) 62, 138, 211
MnlI CCTC 5 cut(s) 16, 202, 214, 216, 331
MseI TTAA 3 cut(s) 156, 249, 291
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 91
NlaIII CATG 1 cut(s) 83
NlaIV GGNNCC 1 cut(s) 342
NmuCI GTSAC 1 cut(s) 331
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
PspN4I GGNNCC 1 cut(s) 342
SaqAI TTAA 3 cut(s) 156, 249, 291
ScrFI CCNGG 1 cut(s) 96
SetI ASST 2 cut(s) 178, 267
Sse9I AATT 3 cut(s) 62, 138, 211
SspI AATATT 1 cut(s) 153
SspMI CTAG 1 cut(s) 195
StyD4I CCNGG 1 cut(s) 94
TaiI ACGT 1 cut(s) 267
TasI AATT 3 cut(s) 62, 138, 211
Tru1I TTAA 3 cut(s) 156, 249, 291
Tru9I TTAA 3 cut(s) 156, 249, 291
TseFI GTSAC 1 cut(s) 331
Tsp45I GTSAC 1 cut(s) 331
TspDTI ATGAA 4 cut(s) 27, 55, 69, 150
XapI RAATTY 2 cut(s) 62, 138
XspI CTAG 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.