Rroxscaffold_3G00263690
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001153
Physical Location & Seq
Reverse (-)
57556675 .. 57560188
3514 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00263690.1

Sequence Viewer

Length: 327 bp
ATGCCTATGGTGGAAGAGGCGATGCCGGTTGTGGAACAGGCAGCTGAGCCATCAAAAACATCATGGGGGCATCTGCATTGGCTGCTCACAGCATCTGCGGGTGGTACGTTAACTGCTGTGCTGGAAGACAGAAGCAAAGGCGGCCTCTTTACCCACACTCGTTTTGACGCTACTGCTCCTGAGAGTGCCGGAGTGAAGCCATATCGTAAGAAAGGGTTGGAACATTATGAAATTTTAGGGGAAATATTTAACACTACTACGCAACGGGTCAACTACATTATGCCTCTAGCCAACTCCCTCCCAATTCAGATGAAGAGCGCAAGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

108

Amino Acids

11.84

Weight (kDa)

6.4

Isoelectric Point (pI)

47.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 98, 141
AcsI RAATTY 1 cut(s) 231
AfaI GTAC 1 cut(s) 106
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
AlwNI CAGNNNCTG 1 cut(s) 95
AoxI GGCC 1 cut(s) 142
ApeKI GCWGC 2 cut(s) 41, 82
ApoI RAATTY 1 cut(s) 231
AspLEI GCGC 1 cut(s) 320
BbsI GAAGAC 1 cut(s) 132
BbvI GCAGC 2 cut(s) 53, 69
BccI CCATC 1 cut(s) 58
BfaI CTAG 1 cut(s) 287
BisI GCNGC 3 cut(s) 42, 83, 142
BlpI GCTNAGC 1 cut(s) 45
BlsI GCNGC 3 cut(s) 43, 84, 143
BmsI GCATC 3 cut(s) 12, 79, 101
BpiI GAAGAC 1 cut(s) 132
Bpu1102I GCTNAGC 1 cut(s) 45
Bse118I RCCGGY 1 cut(s) 25
BseMII CTCAG 2 cut(s) 36, 171
BseXI GCAGC 2 cut(s) 53, 69
BshFI GGCC 1 cut(s) 144
BsiSI CCGG 2 cut(s) 26, 189
BsnI GGCC 1 cut(s) 144
Bsp1720I GCTNAGC 1 cut(s) 45
BspACI CCGC 2 cut(s) 98, 141
BspANI GGCC 1 cut(s) 144
BspCNI CTCAG 2 cut(s) 37, 172
BspQI GCTCTTC 1 cut(s) 308
BsrFI RCCGGY 1 cut(s) 25
BssAI RCCGGY 1 cut(s) 25
Bst6I CTCTTC 2 cut(s) 9, 308
BstAPI GCANNNNNTGC 1 cut(s) 82
BstDEI CTNAG 2 cut(s) 45, 180
BstHHI GCGC 1 cut(s) 320
BstMWI GCNNNNNNNGC 2 cut(s) 82, 141
BstV1I GCAGC 2 cut(s) 53, 69
BstV2I GAAGAC 1 cut(s) 132
BsuRI GGCC 1 cut(s) 144
BtgZI GCGATG 1 cut(s) 35
CaiI CAGNNNCTG 1 cut(s) 95
CfoI GCGC 1 cut(s) 320
Cfr10I RCCGGY 1 cut(s) 25
CseI GACGC 1 cut(s) 176
Csp6I GTAC 1 cut(s) 105
CviAII CATG 1 cut(s) 63
CviJI RGCY 6 cut(s) 44, 49, 82, 144, 199, 290
CviKI_1 RGCY 6 cut(s) 44, 49, 82, 144, 199, 290
CviQI GTAC 1 cut(s) 105
DdeI CTNAG 2 cut(s) 45, 180
Eam1104I CTCTTC 2 cut(s) 9, 308
EarI CTCTTC 2 cut(s) 9, 308
FaeI CATG 1 cut(s) 66
FaiI YATR 5 cut(s) 8, 64, 202, 228, 281
FatI CATG 1 cut(s) 62
FauI CCCGC 1 cut(s) 91
Fnu4HI GCNGC 3 cut(s) 42, 83, 142
Fsp4HI GCNGC 3 cut(s) 42, 83, 142
FspBI CTAG 1 cut(s) 287
GlaI GCGC 1 cut(s) 319
GluI GCNGC 3 cut(s) 42, 83, 142
HaeIII GGCC 1 cut(s) 144
HapII CCGG 2 cut(s) 26, 189
HgaI GACGC 1 cut(s) 176
HhaI GCGC 1 cut(s) 320
Hin1II CATG 1 cut(s) 66
Hin6I GCGC 1 cut(s) 318
HinP1I GCGC 1 cut(s) 318
HincII GTYRAC 2 cut(s) 111, 271
HindII GTYRAC 2 cut(s) 111, 271
HpaI GTTAAC 1 cut(s) 111
HpaII CCGG 2 cut(s) 26, 189
Hpy166II GTNNAC 2 cut(s) 111, 271
Hpy188I TCNGA 1 cut(s) 309
Hpy188III TCNNGA 1 cut(s) 179
Hpy8I GTNNAC 2 cut(s) 111, 271
HpyCH4IV ACGT 1 cut(s) 107
HpyCH4V TGCA 1 cut(s) 76
HpyF10VI GCNNNNNNNGC 2 cut(s) 82, 141
HpyF3I CTNAG 2 cut(s) 45, 180
HpySE526I ACGT 1 cut(s) 107
Hsp92II CATG 1 cut(s) 66
HspAI GCGC 1 cut(s) 318
KspAI GTTAAC 1 cut(s) 111
LguI GCTCTTC 1 cut(s) 308
LmnI GCTCC 1 cut(s) 181
LpnPI CCDG 5 cut(s) 23, 39, 107, 192, 202
Lsp1109I GCAGC 2 cut(s) 53, 69
LweI GCATC 3 cut(s) 12, 79, 101
MaeI CTAG 1 cut(s) 287
MaeII ACGT 1 cut(s) 107
MboII GAAGA 3 cut(s) 26, 137, 325
MluCI AATT 2 cut(s) 231, 303
MmeI TCCRAC 1 cut(s) 198
MnlI CCTC 4 cut(s) 10, 155, 294, 308
MseI TTAA 2 cut(s) 110, 249
MspA1I CMGCKG 1 cut(s) 44
MspI CCGG 2 cut(s) 26, 189
MwoI GCNNNNNNNGC 2 cut(s) 82, 141
NlaIII CATG 1 cut(s) 66
PciSI GCTCTTC 1 cut(s) 308
PkrI GCNGC 3 cut(s) 43, 84, 143
PstNI CAGNNNCTG 1 cut(s) 95
PvuII CAGCTG 1 cut(s) 44
RsaI GTAC 1 cut(s) 106
RsaNI GTAC 1 cut(s) 105
SapI GCTCTTC 1 cut(s) 308
SaqAI TTAA 2 cut(s) 110, 249
SatI GCNGC 3 cut(s) 42, 83, 142
SetI ASST 2 cut(s) 46, 110
SfaNI GCATC 3 cut(s) 12, 79, 101
Sse9I AATT 2 cut(s) 231, 303
SsiI CCGC 2 cut(s) 98, 141
SspI AATATT 1 cut(s) 246
SspMI CTAG 1 cut(s) 287
TaiI ACGT 1 cut(s) 110
TasI AATT 2 cut(s) 231, 303
TauI GCSGC 1 cut(s) 144
Tru1I TTAA 2 cut(s) 110, 249
Tru9I TTAA 2 cut(s) 110, 249
TseI GCWGC 2 cut(s) 41, 82
TspDTI ATGAA 2 cut(s) 243, 326
XapI RAATTY 1 cut(s) 231
XspI CTAG 1 cut(s) 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.