Rh4BG219400
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0001153
Physical Location & Seq
Reverse (-)
37978139 .. 37978693
555 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG219400.1

Sequence Viewer

Length: 393 bp
ATGGCCCCTCAAAAAAAAAAGGAGATAGCCTCTGCCAAGAATAAGAATGTTGATGATGATAATGAAAAGGAAACAGCTGACTGGTCCAACAAAAGAGAAGAAATATTTATAGACATATTGTATGAACATGTGAAGAAAGGGGAATTGCAGGCATCTACTTTCAAAGCAAAAACTTGGGCAGAGATAGGTGATGAATTATTTGCACAAGTAGGCAAAAGATTTTCTCTTGACCAGCTCACTGGTAAATTTAATAGGCTACGCATTTTACATCGTGAATTCTCAGATTTACTAGAGCATACAGGATTTGGGTGGGATCCTGTATCCAACACAGTAACTGCATCTCCAGATGTTTGGGATAATTATCTTCAGGTATTGTTATATGTCAAGCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

130

Amino Acids

15.04

Weight (kDa)

5.63

Isoelectric Point (pI)

29.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-bind_3 PF12776 28 - 121 2.1e-20 Myb/SANT-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 308, 321
AcsI RAATTY 2 cut(s) 245, 275
AcuI CTGAAG 1 cut(s) 350
AflIII ACRYGT 1 cut(s) 127
AgsI TTSAA 1 cut(s) 163
AluBI AGCT 2 cut(s) 77, 235
AluI AGCT 2 cut(s) 77, 235
AlwI GGATC 2 cut(s) 308, 321
AlwNI CAGNNNCTG 1 cut(s) 335
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 245, 275
AspS9I GGNCC 2 cut(s) 4, 84
AsuHPI GGTGA 1 cut(s) 200
AvaII GGWCC 1 cut(s) 84
BamHI GGATCC 1 cut(s) 313
BciVI GTATCC 1 cut(s) 331
BfaI CTAG 1 cut(s) 290
BfuI GTATCC 1 cut(s) 331
Bme18I GGWCC 1 cut(s) 84
BmgT120I GGNCC 2 cut(s) 4, 84
BmiI GGNNCC 2 cut(s) 6, 315
BmsI GCATC 2 cut(s) 161, 347
BplI GAGNNNNNCTC 2 cut(s) 14, 46
BpmI CTGGAG 1 cut(s) 327
BsaBI GATNNNNATC 1 cut(s) 360
BsaXI ACNNNNNCTCC 2 cut(s) 325, 355
Bse1I ACTGG 2 cut(s) 86, 244
Bse8I GATNNNNATC 1 cut(s) 360
BseJI GATNNNNATC 1 cut(s) 360
BseMII CTCAG 1 cut(s) 294
BseNI ACTGG 2 cut(s) 86, 244
BshFI GGCC 1 cut(s) 5
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 313
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 293
BspLI GGNNCC 2 cut(s) 6, 315
BspPI GGATC 2 cut(s) 308, 321
BsrI ACTGG 2 cut(s) 86, 244
BssMI GATC 1 cut(s) 313
Bst4CI ACNGT 1 cut(s) 331
BstC8I GCNNGC 1 cut(s) 150
BstDEI CTNAG 1 cut(s) 280
BstKTI GATC 1 cut(s) 316
BstMBI GATC 1 cut(s) 313
BstNSI RCATGY 1 cut(s) 131
BstX2I RGATCY 1 cut(s) 313
BstXI CCANNNNNNTGG 2 cut(s) 239, 351
BstYI RGATCY 1 cut(s) 313
BsuI GTATCC 1 cut(s) 331
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 237
Cac8I GCNNGC 1 cut(s) 150
CaiI CAGNNNCTG 1 cut(s) 335
Cfr13I GGNCC 2 cut(s) 4, 84
CviAII CATG 1 cut(s) 128
CviJI RGCY 6 cut(s) 5, 29, 77, 235, 256, 388
CviKI_1 RGCY 6 cut(s) 5, 29, 77, 235, 256, 388
DdeI CTNAG 1 cut(s) 280
DpnI GATC 1 cut(s) 315
DpnII GATC 1 cut(s) 313
Eco47I GGWCC 1 cut(s) 84
Eco57I CTGAAG 1 cut(s) 350
EcoRI GAATTC 1 cut(s) 275
FaeI CATG 1 cut(s) 131
FaiI YATR 8 cut(s) 110, 116, 123, 129, 297, 379, 381, 391
FatI CATG 1 cut(s) 127
FspBI CTAG 1 cut(s) 290
GsuI CTGGAG 1 cut(s) 327
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 1 cut(s) 131
HphI GGTGA 1 cut(s) 200
Hpy188I TCNGA 1 cut(s) 283
Hpy188III TCNNGA 3 cut(s) 227, 272, 344
HpyCH4III ACNGT 1 cut(s) 331
HpyCH4V TGCA 3 cut(s) 148, 203, 338
HpyF3I CTNAG 1 cut(s) 280
Hsp92II CATG 1 cut(s) 131
Kzo9I GATC 1 cut(s) 313
LpnPI CCDG 8 cut(s) 67, 134, 225, 245, 285, 330, 353, 357
LweI GCATC 2 cut(s) 161, 347
MaeI CTAG 1 cut(s) 290
MaeIII GTNAC 1 cut(s) 331
MalI GATC 1 cut(s) 315
MboI GATC 1 cut(s) 313
MboII GAAGA 3 cut(s) 110, 145, 356
MflI RGATCY 1 cut(s) 313
MluCI AATT 5 cut(s) 143, 194, 245, 275, 358
MmeI TCCRAC 2 cut(s) 111, 348
MnlI CCTC 2 cut(s) 18, 40
MseI TTAA 1 cut(s) 249
MspA1I CMGCKG 1 cut(s) 77
NdeII GATC 1 cut(s) 313
NlaIII CATG 1 cut(s) 131
NlaIV GGNNCC 2 cut(s) 6, 315
NspI RCATGY 1 cut(s) 131
PciI ACATGT 1 cut(s) 127
PscI ACATGT 1 cut(s) 127
PspN4I GGNNCC 2 cut(s) 6, 315
PspPI GGNCC 2 cut(s) 4, 84
PstNI CAGNNNCTG 1 cut(s) 335
PsuI RGATCY 1 cut(s) 313
PvuII CAGCTG 1 cut(s) 77
SaqAI TTAA 1 cut(s) 249
Sau3AI GATC 1 cut(s) 313
Sau96I GGNCC 2 cut(s) 4, 84
SetI ASST 4 cut(s) 79, 190, 237, 372
SfaNI GCATC 2 cut(s) 161, 347
SinI GGWCC 1 cut(s) 84
Sse9I AATT 5 cut(s) 143, 194, 245, 275, 358
SspI AATATT 1 cut(s) 105
SspMI CTAG 1 cut(s) 290
TaaI ACNGT 1 cut(s) 331
TasI AATT 5 cut(s) 143, 194, 245, 275, 358
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TscAI CASTG 1 cut(s) 244
TspDTI ATGAA 3 cut(s) 78, 138, 207
TspRI CASTG 1 cut(s) 244
VpaK11BI GGWCC 1 cut(s) 84
XapI RAATTY 2 cut(s) 245, 275
XceI RCATGY 1 cut(s) 131
XspI CTAG 1 cut(s) 290
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.