RLG00000013335
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
OG0001153
Physical Location & Seq
Reverse (-)
29990404 .. 29991177
774 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000013335

Sequence Viewer

Length: 513 bp
ATGGCCCCTCAAAAAAAAGAGGAGATAGCCTCTGCCAAGAATAAGAATGTTGATGATGATAATGAAAAGGAAACAGCTGACTGGTCCAACAAAAGGGAAGAAATATTTAGAGACATATTGTACGAACATGTGAAGAAAGGGGAATTGCAGACATCTACTTTCAAAGCAAAAACTTGGGCAGAGATAGGTGATGAATTATTTGCACAAAAAAAGCCCAAGATGAAGAAATTTCGGCTTAAAGGCTTAGCCCACTATGAAACTCTAGGTGAAATATTCAACACCACTACTGCAACAGGTCAAATGCATTATGCATCTGGCCAAGTTCCAAAAAACTTTGATGAGGAGAGTCGATTAGAACATAGATTTCTAAACACTGGTGTTCACGTAAAGATTCATGATAAAGTTGATGATGTAGATGTCATTTATATTGATGGAGAATGTGATGGAGGCGAAGGAAAAAGGAAATCTACAACTGATGCCCCTTCTTCATATGATCGCAAGCCAAAGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

171

Amino Acids

19.49

Weight (kDa)

6.61

Isoelectric Point (pI)

41.21

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-bind_3 PF12776 28 - 93 9.7e-06 Myb/SANT-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 316
AcsI RAATTY 1 cut(s) 227
AfaI GTAC 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 93
AflIII ACRYGT 1 cut(s) 127
AgsI TTSAA 2 cut(s) 163, 277
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
Alw26I GTCTC 1 cut(s) 105
AoxI GGCC 2 cut(s) 3, 316
ApoI RAATTY 1 cut(s) 227
AspS9I GGNCC 2 cut(s) 4, 84
AsuHPI GGTGA 2 cut(s) 200, 278
AvaII GGWCC 1 cut(s) 84
BalI TGGCCA 1 cut(s) 318
BccI CCATC 2 cut(s) 425, 437
BcoDI GTCTC 1 cut(s) 105
BfaI CTAG 1 cut(s) 263
BlpI GCTNAGC 1 cut(s) 244
Bme18I GGWCC 1 cut(s) 84
BmgT120I GGNCC 2 cut(s) 4, 84
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 2 cut(s) 320, 466
BplI GAGNNNNNCTC 2 cut(s) 14, 46
Bpu1102I GCTNAGC 1 cut(s) 244
BsaAI YACGTR 1 cut(s) 385
Bsc4I CCNNNNNNNGG 1 cut(s) 93
Bse1I ACTGG 2 cut(s) 86, 379
BseLI CCNNNNNNNGG 1 cut(s) 93
BseNI ACTGG 2 cut(s) 86, 379
BseRI GAGGAG 2 cut(s) 35, 356
BshFI GGCC 2 cut(s) 5, 318
BslI CCNNNNNNNGG 1 cut(s) 93
BsmAI GTCTC 1 cut(s) 105
BsnI GGCC 2 cut(s) 5, 318
Bsp143I GATC 1 cut(s) 493
Bsp1720I GCTNAGC 1 cut(s) 244
BspANI GGCC 2 cut(s) 5, 318
BspHI TCATGA 1 cut(s) 394
BspLI GGNNCC 1 cut(s) 6
BsrI ACTGG 2 cut(s) 86, 379
BssMI GATC 1 cut(s) 493
BstBAI YACGTR 1 cut(s) 385
BstC8I GCNNGC 1 cut(s) 500
BstDEI CTNAG 1 cut(s) 244
BstKTI GATC 1 cut(s) 496
BstMAI GTCTC 1 cut(s) 105
BstMBI GATC 1 cut(s) 493
BstNSI RCATGY 1 cut(s) 131
BsuRI GGCC 2 cut(s) 5, 318
BtsIMutI CAGTG 1 cut(s) 372
Cac8I GCNNGC 1 cut(s) 500
CciI TCATGA 1 cut(s) 394
Cfr13I GGNCC 2 cut(s) 4, 84
Csp6I GTAC 1 cut(s) 121
CviAII CATG 2 cut(s) 128, 395
CviJI RGCY 9 cut(s) 5, 29, 77, 214, 235, 243, 248, 318, 502
CviKI_1 RGCY 9 cut(s) 5, 29, 77, 214, 235, 243, 248, 318, 502
CviQI GTAC 1 cut(s) 121
DdeI CTNAG 1 cut(s) 244
DpnI GATC 1 cut(s) 495
DpnII GATC 1 cut(s) 493
EaeI YGGCCR 1 cut(s) 316
Eco47I GGWCC 1 cut(s) 84
EcoT22I ATGCAT 2 cut(s) 306, 313
FaeI CATG 2 cut(s) 131, 398
FaiI YATR 9 cut(s) 116, 129, 255, 309, 360, 396, 426, 490, 492
FatI CATG 2 cut(s) 127, 394
FauNDI CATATG 1 cut(s) 490
FspBI CTAG 1 cut(s) 263
HaeIII GGCC 2 cut(s) 5, 318
Hin1II CATG 2 cut(s) 131, 398
HinfI GANTC 2 cut(s) 346, 391
HphI GGTGA 2 cut(s) 200, 278
Hpy166II GTNNAC 1 cut(s) 382
Hpy188III TCNNGA 1 cut(s) 395
Hpy8I GTNNAC 1 cut(s) 382
HpyAV CCTTC 2 cut(s) 446, 492
HpyCH4IV ACGT 1 cut(s) 384
HpyCH4V TGCA 5 cut(s) 148, 203, 290, 304, 311
HpyF3I CTNAG 1 cut(s) 244
HpySE526I ACGT 1 cut(s) 384
Hsp92II CATG 2 cut(s) 131, 398
Kzo9I GATC 1 cut(s) 493
LpnPI CCDG 4 cut(s) 67, 279, 300, 360
LweI GCATC 2 cut(s) 320, 466
MaeI CTAG 1 cut(s) 263
MaeII ACGT 1 cut(s) 384
MalI GATC 1 cut(s) 495
MboI GATC 1 cut(s) 493
MboII GAAGA 4 cut(s) 110, 145, 235, 477
MlsI TGGCCA 1 cut(s) 318
MluCI AATT 3 cut(s) 143, 194, 227
MluNI TGGCCA 1 cut(s) 318
MlyI GAGTC 1 cut(s) 355
MmeI TCCRAC 1 cut(s) 111
MnlI CCTC 5 cut(s) 13, 18, 40, 334, 440
Mox20I TGGCCA 1 cut(s) 318
Mph1103I ATGCAT 2 cut(s) 306, 313
MscI TGGCCA 1 cut(s) 318
MseI TTAA 1 cut(s) 237
Msp20I TGGCCA 1 cut(s) 318
MspA1I CMGCKG 1 cut(s) 77
NdeI CATATG 1 cut(s) 490
NdeII GATC 1 cut(s) 493
NlaIII CATG 2 cut(s) 131, 398
NlaIV GGNNCC 1 cut(s) 6
NsiI ATGCAT 2 cut(s) 306, 313
NspI RCATGY 1 cut(s) 131
PagI TCATGA 1 cut(s) 394
PciI ACATGT 1 cut(s) 127
PfeI GAWTC 1 cut(s) 391
PleI GAGTC 1 cut(s) 354
PpsI GAGTC 1 cut(s) 354
Ppu21I YACGTR 1 cut(s) 385
PscI ACATGT 1 cut(s) 127
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 2 cut(s) 4, 84
PvuII CAGCTG 1 cut(s) 77
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
SaqAI TTAA 1 cut(s) 237
Sau3AI GATC 1 cut(s) 493
Sau96I GGNCC 2 cut(s) 4, 84
SchI GAGTC 1 cut(s) 355
SetI ASST 5 cut(s) 79, 190, 268, 298, 387
SfaNI GCATC 2 cut(s) 320, 466
SinI GGWCC 1 cut(s) 84
Sse9I AATT 3 cut(s) 143, 194, 227
SspI AATATT 2 cut(s) 105, 273
SspMI CTAG 1 cut(s) 263
TaiI ACGT 1 cut(s) 387
TaqI TCGA 1 cut(s) 349
TasI AATT 3 cut(s) 143, 194, 227
TfiI GAWTC 1 cut(s) 391
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TscAI CASTG 1 cut(s) 379
TspDTI ATGAA 6 cut(s) 78, 207, 236, 270, 383, 477
TspRI CASTG 1 cut(s) 379
VpaK11BI GGWCC 1 cut(s) 84
XapI RAATTY 1 cut(s) 227
XceI RCATGY 1 cut(s) 131
XspI CTAG 1 cut(s) 263
Zsp2I ATGCAT 2 cut(s) 306, 313
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.