Rh2CG067600
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0001153
Physical Location & Seq
Forward (+)
5615323 .. 5615715
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG067600.1

Sequence Viewer

Length: 393 bp
ATGAAGAAATTTCGGCTTAAAGGCTTGGCCCACTATGAAAGTCTAGGTGAAATATTCAACACCACTACTGCAACAGGTCAAATTCATTATGCATCTGGCCAAGTTCCACAAAACTCTGATGAGGAGCGTCAATTAGAGCATAGATTTCTAAACACGGGTGTTCACGTAAAGATTCATGATAAAGTTGATGATGTAGATGTCATTAATATTGATGGAGAATGTGATGGAGGTAAAGGAAAAAGAAAATCTACAATTGATGCCCCTTCTTCATATGATCGAAAGCCAAAGAAATGGGAAAAAATGGAGAGTTATTTGGATGTTTGTAGTGAAGTCATGGCTGAAAAATTAAAGCGTCAAAAGGACAAAAGTACTTCTGAGCTGCCAGGATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

130

Amino Acids

14.74

Weight (kDa)

6.96

Isoelectric Point (pI)

44.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 97
AcsI RAATTY 2 cut(s) 8, 81
AfaI GTAC 1 cut(s) 370
AgsI TTSAA 1 cut(s) 58
AjnI CCWGG 1 cut(s) 382
AluBI AGCT 1 cut(s) 379
AluI AGCT 1 cut(s) 379
AoxI GGCC 2 cut(s) 27, 97
ApeKI GCWGC 1 cut(s) 379
ApoI RAATTY 2 cut(s) 8, 81
AseI ATTAAT 1 cut(s) 204
AspS9I GGNCC 1 cut(s) 28
AsuHPI GGTGA 1 cut(s) 59
BalI TGGCCA 1 cut(s) 99
BbvI GCAGC 1 cut(s) 366
BccI CCATC 2 cut(s) 206, 218
BciT130I CCWGG 1 cut(s) 384
BfaI CTAG 1 cut(s) 44
BisI GCNGC 1 cut(s) 380
BlsI GCNGC 1 cut(s) 381
BmcAI AGTACT 1 cut(s) 370
Bme1390I CCNGG 1 cut(s) 384
BmgT120I GGNCC 1 cut(s) 28
BmrFI CCNGG 1 cut(s) 384
BmsI GCATC 2 cut(s) 101, 247
BsaAI YACGTR 1 cut(s) 166
BseBI CCWGG 1 cut(s) 384
BseGI GGATG 1 cut(s) 322
BseMII CTCAG 1 cut(s) 366
BseRI GAGGAG 1 cut(s) 137
BseXI GCAGC 1 cut(s) 366
BshFI GGCC 2 cut(s) 29, 99
BsnI GGCC 2 cut(s) 29, 99
Bsp143I GATC 1 cut(s) 274
BspANI GGCC 2 cut(s) 29, 99
BspCNI CTCAG 1 cut(s) 367
BspHI TCATGA 1 cut(s) 175
BssMI GATC 1 cut(s) 274
Bst2UI CCWGG 1 cut(s) 384
BstBAI YACGTR 1 cut(s) 166
BstDEI CTNAG 1 cut(s) 375
BstF5I GGATG 1 cut(s) 322
BstKTI GATC 1 cut(s) 277
BstMBI GATC 1 cut(s) 274
BstNI CCWGG 1 cut(s) 384
BstSCI CCNGG 1 cut(s) 382
BstV1I GCAGC 1 cut(s) 366
BstXI CCANNNNNNTGG 1 cut(s) 291
BsuRI GGCC 2 cut(s) 29, 99
BtsCI GGATG 1 cut(s) 322
CciI TCATGA 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 28
CseI GACGC 2 cut(s) 116, 341
Csp6I GTAC 1 cut(s) 369
CviAII CATG 2 cut(s) 176, 334
CviJI RGCY 7 cut(s) 16, 24, 29, 99, 283, 338, 379
CviKI_1 RGCY 7 cut(s) 16, 24, 29, 99, 283, 338, 379
CviQI GTAC 1 cut(s) 369
DdeI CTNAG 1 cut(s) 375
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
EaeI YGGCCR 1 cut(s) 97
EcoRII CCWGG 1 cut(s) 382
EcoT22I ATGCAT 1 cut(s) 94
FaeI CATG 2 cut(s) 179, 337
FaiI YATR 8 cut(s) 36, 90, 141, 177, 271, 273, 335, 391
FatI CATG 2 cut(s) 175, 333
FauNDI CATATG 1 cut(s) 271
Fnu4HI GCNGC 1 cut(s) 380
FokI GGATG 1 cut(s) 329
Fsp4HI GCNGC 1 cut(s) 380
FspBI CTAG 1 cut(s) 44
GluI GCNGC 1 cut(s) 380
HaeIII GGCC 2 cut(s) 29, 99
HgaI GACGC 2 cut(s) 116, 341
Hin1II CATG 2 cut(s) 179, 337
HinfI GANTC 1 cut(s) 172
HphI GGTGA 1 cut(s) 59
Hpy166II GTNNAC 1 cut(s) 163
Hpy188I TCNGA 2 cut(s) 118, 376
Hpy188III TCNNGA 1 cut(s) 176
Hpy8I GTNNAC 1 cut(s) 163
HpyAV CCTTC 1 cut(s) 273
HpyCH4IV ACGT 1 cut(s) 165
HpyCH4V TGCA 2 cut(s) 71, 92
HpyF3I CTNAG 1 cut(s) 375
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 2 cut(s) 179, 337
Kzo9I GATC 1 cut(s) 274
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 3 cut(s) 60, 81, 369
Lsp1109I GCAGC 1 cut(s) 366
LweI GCATC 2 cut(s) 101, 247
MaeI CTAG 1 cut(s) 44
MaeII ACGT 1 cut(s) 165
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MboII GAAGA 2 cut(s) 16, 258
MfeI CAATTG 1 cut(s) 252
MlsI TGGCCA 1 cut(s) 99
MluCI AATT 5 cut(s) 8, 81, 131, 252, 344
MluNI TGGCCA 1 cut(s) 99
MnlI CCTC 2 cut(s) 115, 221
Mox20I TGGCCA 1 cut(s) 99
Mph1103I ATGCAT 1 cut(s) 94
MscI TGGCCA 1 cut(s) 99
MseI TTAA 3 cut(s) 18, 204, 347
Msp20I TGGCCA 1 cut(s) 99
MspR9I CCNGG 1 cut(s) 384
MunI CAATTG 1 cut(s) 252
MvaI CCWGG 1 cut(s) 384
NdeI CATATG 1 cut(s) 271
NdeII GATC 1 cut(s) 274
NlaIII CATG 2 cut(s) 179, 337
NsiI ATGCAT 1 cut(s) 94
PagI TCATGA 1 cut(s) 175
PfeI GAWTC 1 cut(s) 172
PkrI GCNGC 1 cut(s) 381
Ppu21I YACGTR 1 cut(s) 166
PshBI ATTAAT 1 cut(s) 204
Psp6I CCWGG 1 cut(s) 382
PspGI CCWGG 1 cut(s) 382
PspPI GGNCC 1 cut(s) 28
RsaI GTAC 1 cut(s) 370
RsaNI GTAC 1 cut(s) 369
SaqAI TTAA 3 cut(s) 18, 204, 347
SatI GCNGC 1 cut(s) 380
Sau3AI GATC 1 cut(s) 274
Sau96I GGNCC 1 cut(s) 28
ScaI AGTACT 1 cut(s) 370
ScrFI CCNGG 1 cut(s) 384
SetI ASST 5 cut(s) 49, 79, 168, 232, 381
SfaNI GCATC 2 cut(s) 101, 247
Sse9I AATT 5 cut(s) 8, 81, 131, 252, 344
SspI AATATT 2 cut(s) 54, 208
SspMI CTAG 1 cut(s) 44
StyD4I CCNGG 1 cut(s) 382
TaiI ACGT 1 cut(s) 168
TaqI TCGA 1 cut(s) 277
TasI AATT 5 cut(s) 8, 81, 131, 252, 344
TatI WGTACW 1 cut(s) 368
TfiI GAWTC 1 cut(s) 172
Tru1I TTAA 3 cut(s) 18, 204, 347
Tru9I TTAA 3 cut(s) 18, 204, 347
TseI GCWGC 1 cut(s) 379
TspDTI ATGAA 5 cut(s) 17, 51, 74, 164, 258
VspI ATTAAT 1 cut(s) 204
XapI RAATTY 2 cut(s) 8, 81
XspI CTAG 1 cut(s) 44
ZrmI AGTACT 1 cut(s) 370
Zsp2I ATGCAT 1 cut(s) 94
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.