Rroxscaffold_3G00226530
MYB Family

Myb/SANT-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
10080288 .. 10081011
724 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00226530.1

Sequence Viewer

Length: 495 bp
ATGGCCTCTAATGAAGTGGAGATTGATGATAAAGCTGAATGGTCTGCTAAGAATGAAGGAAAATTTATTCGTATTTTGCATAAGCATGTGAAAAAAGGAGATATGCAAACATCCACTTTCAAAAAGAAAATTTGGATGGAAATAAGTGATGAGTTGTTTGCTGAAACTACGAAAAGATACATTGTGAGAGTACCGGGAGTGAAGCCCTATCGTAAGAAAGGCTTGGAACATTATGAAACTTTAGGGGAAATATTCAATACTACTACTGCAACGGGTCAACTACATTATGCCTCTAGCCAGTTCCCTCCCAATTCAGATGATGAGCGCGAGTTAGAGAATAAGTTTCTTAACAATGGAGTTCACATCATTAATCTTGATGAGGATTTCAATGTTAATAATACTCAAAATGAGATCAGAGGGAAAAGAAAAGCTGTGACAGAGGCTTCACCTTCAGAGCGTCGAACAAAAAAAGGGACAAAATGGAAGCCTACTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

164

Amino Acids

19.0

Weight (kDa)

9.15

Isoelectric Point (pI)

35.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 327
AcsI RAATTY 2 cut(s) 62, 129
AcuI CTGAAG 1 cut(s) 435
AfaI GTAC 1 cut(s) 192
AgsI TTSAA 3 cut(s) 121, 256, 388
AluBI AGCT 2 cut(s) 35, 431
AluI AGCT 2 cut(s) 35, 431
AoxI GGCC 1 cut(s) 3
ApoI RAATTY 2 cut(s) 62, 129
AseI ATTAAT 1 cut(s) 369
AspLEI GCGC 1 cut(s) 327
AsuC2I CCSGG 1 cut(s) 195
AsuHPI GGTGA 1 cut(s) 438
BccI CCATC 1 cut(s) 130
BcnI CCSGG 1 cut(s) 195
BfaI CTAG 1 cut(s) 294
Bme1390I CCNGG 1 cut(s) 195
BmrFI CCNGG 1 cut(s) 195
BpuMI CCSGG 1 cut(s) 195
Bse1I ACTGG 1 cut(s) 298
BseGI GGATG 2 cut(s) 110, 141
BseNI ACTGG 1 cut(s) 298
Bsh1236I CGCG 1 cut(s) 327
BshFI GGCC 1 cut(s) 5
BsiSI CCGG 1 cut(s) 194
BslFI GGGAC 1 cut(s) 487
BsmFI GGGAC 1 cut(s) 487
BsnI GGCC 1 cut(s) 5
Bsp143I GATC 1 cut(s) 411
BspANI GGCC 1 cut(s) 5
BspFNI CGCG 1 cut(s) 327
BsrI ACTGG 1 cut(s) 298
BssMI GATC 1 cut(s) 411
BstDEI CTNAG 2 cut(s) 48, 492
BstF5I GGATG 2 cut(s) 110, 141
BstFNI CGCG 1 cut(s) 327
BstHHI GCGC 1 cut(s) 327
BstKTI GATC 1 cut(s) 414
BstMBI GATC 1 cut(s) 411
BstNSI RCATGY 1 cut(s) 89
BstSCI CCNGG 1 cut(s) 193
BstUI CGCG 1 cut(s) 327
BsuRI GGCC 1 cut(s) 5
BtsCI GGATG 2 cut(s) 110, 141
CfoI GCGC 1 cut(s) 327
CseI GACGC 1 cut(s) 446
Csp6I GTAC 1 cut(s) 191
CviAII CATG 1 cut(s) 86
CviJI RGCY 8 cut(s) 5, 35, 205, 222, 297, 431, 443, 487
CviKI_1 RGCY 8 cut(s) 5, 35, 205, 222, 297, 431, 443, 487
CviQI GTAC 1 cut(s) 191
DdeI CTNAG 2 cut(s) 48, 492
DpnI GATC 1 cut(s) 413
DpnII GATC 1 cut(s) 411
Eco57I CTGAAG 1 cut(s) 435
FaeI CATG 1 cut(s) 89
FaiI YATR 5 cut(s) 81, 87, 104, 234, 288
FalI AAGNNNNNCTT 2 cut(s) 206, 238
FaqI GGGAC 1 cut(s) 487
FatI CATG 1 cut(s) 85
FokI GGATG 2 cut(s) 97, 148
FspBI CTAG 1 cut(s) 294
GlaI GCGC 1 cut(s) 326
HaeIII GGCC 1 cut(s) 5
HapII CCGG 1 cut(s) 194
HgaI GACGC 1 cut(s) 446
HhaI GCGC 1 cut(s) 327
Hin1II CATG 1 cut(s) 89
Hin6I GCGC 1 cut(s) 325
HinP1I GCGC 1 cut(s) 325
HincII GTYRAC 1 cut(s) 278
HindII GTYRAC 1 cut(s) 278
HpaII CCGG 1 cut(s) 194
HphI GGTGA 1 cut(s) 438
Hpy166II GTNNAC 2 cut(s) 278, 361
Hpy188I TCNGA 3 cut(s) 316, 416, 454
Hpy188III TCNNGA 1 cut(s) 374
Hpy8I GTNNAC 2 cut(s) 278, 361
Hpy99I CGWCG 1 cut(s) 462
HpyAV CCTTC 2 cut(s) 50, 459
HpyCH4V TGCA 3 cut(s) 79, 106, 269
HpyF3I CTNAG 2 cut(s) 48, 492
Hsp92II CATG 1 cut(s) 89
HspAI GCGC 1 cut(s) 325
Kzo9I GATC 1 cut(s) 411
LpnPI CCDG 2 cut(s) 207, 311
MaeI CTAG 1 cut(s) 294
MaeIII GTNAC 1 cut(s) 433
MalI GATC 1 cut(s) 413
MboI GATC 1 cut(s) 411
MluCI AATT 3 cut(s) 62, 129, 310
MnlI CCTC 6 cut(s) 16, 301, 315, 373, 410, 433
MseI TTAA 3 cut(s) 348, 369, 393
MslI CAYNNNNRTG 1 cut(s) 84
MspI CCGG 1 cut(s) 194
MspR9I CCNGG 1 cut(s) 195
MvnI CGCG 1 cut(s) 327
NciI CCSGG 1 cut(s) 195
NdeII GATC 1 cut(s) 411
NlaIII CATG 1 cut(s) 89
NmuCI GTSAC 1 cut(s) 433
NspI RCATGY 1 cut(s) 89
PshBI ATTAAT 1 cut(s) 369
RsaI GTAC 1 cut(s) 192
RsaNI GTAC 1 cut(s) 191
RseI CAYNNNNRTG 1 cut(s) 84
SaqAI TTAA 3 cut(s) 348, 369, 393
Sau3AI GATC 1 cut(s) 411
ScrFI CCNGG 1 cut(s) 195
SetI ASST 3 cut(s) 37, 433, 451
SmiMI CAYNNNNRTG 1 cut(s) 84
Sse9I AATT 3 cut(s) 62, 129, 310
SspI AATATT 1 cut(s) 252
SspMI CTAG 1 cut(s) 294
StyD4I CCNGG 1 cut(s) 193
TaqI TCGA 1 cut(s) 460
TasI AATT 3 cut(s) 62, 129, 310
Tru1I TTAA 3 cut(s) 348, 369, 393
Tru9I TTAA 3 cut(s) 348, 369, 393
TseFI GTSAC 1 cut(s) 433
Tsp45I GTSAC 1 cut(s) 433
TspDTI ATGAA 3 cut(s) 27, 69, 249
VspI ATTAAT 1 cut(s) 369
XapI RAATTY 2 cut(s) 62, 129
XceI RCATGY 1 cut(s) 89
XspI CTAG 1 cut(s) 294
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.