Rmu_sc0007671.1_g000018
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007671.1
OG0001153
Physical Location & Seq
Reverse (-)
79871 .. 80164
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007671.1_g000018.1.cds

Sequence Viewer

Length: 294 bp
atgaagccctatcgtaagaaaggcttggaccattatgaaactttaggggaaatattcaatactactactgcaacaggtcaactacaatatgcctctagccagctccctcccaattcagattatgagtgtgagttagagaacaagtttcttaacaatggagttcacatcaatcttgatgaggatttcaatgttaataatactcaaaatgagatcagagggaaaagaaaagttgtgatagaggctctaccttcagagggtcgaacaaaaaatgggacaaaatggaagcctacttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

97

Amino Acids

11.09

Weight (kDa)

6.73

Isoelectric Point (pI)

41.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 234
AfiI CCNNNNNNNGG 1 cut(s) 254
AgsI TTSAA 2 cut(s) 58, 187
AluBI AGCT 1 cut(s) 103
AluI AGCT 1 cut(s) 103
AspS9I GGNCC 1 cut(s) 28
AvaII GGWCC 1 cut(s) 28
BfaI CTAG 1 cut(s) 96
Bme18I GGWCC 1 cut(s) 28
BmgT120I GGNCC 1 cut(s) 28
Bsc4I CCNNNNNNNGG 1 cut(s) 254
BseLI CCNNNNNNNGG 1 cut(s) 254
BslFI GGGAC 1 cut(s) 286
BslI CCNNNNNNNGG 1 cut(s) 254
BsmFI GGGAC 1 cut(s) 286
Bsp143I GATC 1 cut(s) 210
BssMI GATC 1 cut(s) 210
BstC8I GCNNGC 1 cut(s) 101
BstDEI CTNAG 1 cut(s) 291
BstKTI GATC 1 cut(s) 213
BstMBI GATC 1 cut(s) 210
Cac8I GCNNGC 1 cut(s) 101
Cfr13I GGNCC 1 cut(s) 28
CviJI RGCY 6 cut(s) 7, 24, 99, 103, 242, 286
CviKI_1 RGCY 6 cut(s) 7, 24, 99, 103, 242, 286
DdeI CTNAG 1 cut(s) 291
DpnI GATC 1 cut(s) 212
DpnII GATC 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 28
Eco57I CTGAAG 1 cut(s) 234
FaiI YATR 3 cut(s) 36, 90, 123
FalI AAGNNNNNCTT 2 cut(s) 8, 40
FaqI GGGAC 1 cut(s) 286
FspBI CTAG 1 cut(s) 96
HincII GTYRAC 1 cut(s) 80
HindII GTYRAC 1 cut(s) 80
Hpy166II GTNNAC 2 cut(s) 80, 163
Hpy188I TCNGA 3 cut(s) 118, 215, 253
Hpy188III TCNNGA 1 cut(s) 173
Hpy8I GTNNAC 2 cut(s) 80, 163
HpyAV CCTTC 1 cut(s) 258
HpyCH4V TGCA 1 cut(s) 71
HpyF3I CTNAG 1 cut(s) 291
Kzo9I GATC 1 cut(s) 210
LmnI GCTCC 1 cut(s) 108
LpnPI CCDG 2 cut(s) 60, 113
MaeI CTAG 1 cut(s) 96
MalI GATC 1 cut(s) 212
MboI GATC 1 cut(s) 210
MluCI AATT 1 cut(s) 112
MnlI CCTC 6 cut(s) 103, 117, 172, 209, 232, 247
MseI TTAA 2 cut(s) 150, 192
NdeII GATC 1 cut(s) 210
PspPI GGNCC 1 cut(s) 28
SaqAI TTAA 2 cut(s) 150, 192
Sau3AI GATC 1 cut(s) 210
Sau96I GGNCC 1 cut(s) 28
SetI ASST 3 cut(s) 79, 105, 250
SgeI CNNG 6 cut(s) 37, 87, 108, 112, 154, 185
SinI GGWCC 1 cut(s) 28
Sse9I AATT 1 cut(s) 112
SspI AATATT 1 cut(s) 54
SspMI CTAG 1 cut(s) 96
TaqI TCGA 1 cut(s) 259
TasI AATT 1 cut(s) 112
Tru1I TTAA 2 cut(s) 150, 192
Tru9I TTAA 2 cut(s) 150, 192
TspDTI ATGAA 2 cut(s) 17, 51
VpaK11BI GGWCC 1 cut(s) 28
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.