Rmu_sc0005327.1_g000016
MYB Family

Myb/SANT-like DNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005327.1
OG0001153
Physical Location & Seq
Reverse (-)
87851 .. 88823
973 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005327.1_g000016.1.cds

Sequence Viewer

Length: 885 bp
atgttgggtgacatttacgctcactatgtgcaattttctctcaacaatgacaaagccgaatggtctgctaagaatgaaggaaaattcattcgtattttgcatgagcatgtgaaaaaaggagatatgcaaacattcactttcaaaaagaaaatttggatggaaataagtgatgagttgtttgctgaaactatgaaaagatacactgtggcacaactcaagtctaagttcaatagactaagcaaaaaacatcgtgaattttctgatttgattgagaataccggatttggatgggaccctattgcaaacactgttactgcatcagaggaagtatgggctacttatattaagagagtaccaggagtgaagccctatagtaagaaaggcttggaacattatgaaactttaggggaaatattcaatactactactacaactggtcaactacattatgcctctagccagccccctcccaattcagatgatgagcgcgagttagagaataagtttagtaacaatggagttcacatcaatcttgatgaggatttcgatgttaataatcaaaatgagatcagagggaaaagaaaagctgtgacagaggctccaccttcagagcgtcgtacaaaaaaatgggacaaaatggaagcctacttagaaatttgtggcgaagtgatgaaagaaaagctccaacaaagaaaagaaaaaaatgctgaagagaataaggagaagtactccattgaagagtgtgtgcaaattgtggaaacattgggagacattgatcatgccacatttattaaaatgatggataaacttatagttgttgaatggaggaggcttttccttaccatgtcaaatgaaagaaggagagcttggctagctaatctctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-bind_3

Protein Analysis

294

Amino Acids

34.52

Weight (kDa)

6.74

Isoelectric Point (pI)

45.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 489
AcsI RAATTY 4 cut(s) 83, 150, 254, 654
AcuI CTGAAG 2 cut(s) 591, 729
AdeI CACNNNGTG 1 cut(s) 28
AfaI GTAC 3 cut(s) 354, 619, 728
AgsI TTSAA 5 cut(s) 142, 229, 418, 737, 821
AjnI CCWGG 1 cut(s) 355
AjuI GAANNNNNNNTTGG 2 cut(s) 850, 882
AluBI AGCT 4 cut(s) 587, 682, 866, 875
AluI AGCT 4 cut(s) 587, 682, 866, 875
Alw26I GTCTC 1 cut(s) 762
ApoI RAATTY 4 cut(s) 83, 150, 254, 654
AspLEI GCGC 1 cut(s) 489
AspS9I GGNCC 1 cut(s) 292
AsuHPI GGTGA 1 cut(s) 20
AsuNHI GCTAGC 1 cut(s) 871
AvaII GGWCC 1 cut(s) 292
BccI CCATC 3 cut(s) 151, 282, 793
BcgI CGANNNNNNTGC 2 cut(s) 47, 81
BciT130I CCWGG 1 cut(s) 357
BclI TGATCA 1 cut(s) 775
BcoDI GTCTC 1 cut(s) 762
BfaI CTAG 3 cut(s) 456, 872, 883
BfmI CTRYAG 1 cut(s) 370
BmcAI AGTACT 1 cut(s) 728
Bme1390I CCNGG 1 cut(s) 357
Bme18I GGWCC 1 cut(s) 292
BmgT120I GGNCC 1 cut(s) 292
BmiI GGNNCC 3 cut(s) 293, 294, 600
BmrFI CCNGG 1 cut(s) 357
BmsI GCATC 1 cut(s) 326
BmtI GCTAGC 1 cut(s) 875
BplI GAGNNNNNCTC 2 cut(s) 713, 745
BpuEI CTTGAG 1 cut(s) 200
BsaWI WCCGGW 1 cut(s) 278
BsaXI ACNNNNNCTCC 2 cut(s) 583, 613
Bse1I ACTGG 1 cut(s) 439
BseBI CCWGG 1 cut(s) 357
BseGI GGATG 2 cut(s) 162, 293
BseNI ACTGG 1 cut(s) 439
BseRI GAGGAG 1 cut(s) 841
Bsh1236I CGCG 1 cut(s) 489
BsiSI CCGG 1 cut(s) 279
BslFI GGGAC 2 cut(s) 305, 644
BsmAI GTCTC 1 cut(s) 762
BsmFI GGGAC 2 cut(s) 305, 644
Bsp143I GATC 2 cut(s) 567, 775
BspFNI CGCG 1 cut(s) 489
BspLI GGNNCC 3 cut(s) 293, 294, 600
BspOI GCTAGC 1 cut(s) 875
BsrI ACTGG 1 cut(s) 439
BssMI GATC 2 cut(s) 567, 775
Bst2UI CCWGG 1 cut(s) 357
Bst4CI ACNGT 2 cut(s) 205, 310
Bst6I CTCTTC 2 cut(s) 705, 732
BstC8I GCNNGC 2 cut(s) 461, 873
BstDEI CTNAG 4 cut(s) 69, 222, 236, 649
BstF5I GGATG 2 cut(s) 162, 293
BstFNI CGCG 1 cut(s) 489
BstHHI GCGC 1 cut(s) 489
BstKTI GATC 2 cut(s) 570, 778
BstMAI GTCTC 1 cut(s) 762
BstMBI GATC 2 cut(s) 567, 775
BstMWI GCNNNNNNNGC 1 cut(s) 872
BstNI CCWGG 1 cut(s) 357
BstNSI RCATGY 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 355
BstSFI CTRYAG 1 cut(s) 370
BstUI CGCG 1 cut(s) 489
BtsCI GGATG 2 cut(s) 162, 293
BtsIMutI CAGTG 2 cut(s) 201, 306
Cac8I GCNNGC 2 cut(s) 461, 873
CfoI GCGC 1 cut(s) 489
Cfr13I GGNCC 1 cut(s) 292
CseI GACGC 1 cut(s) 602
Csp6I GTAC 3 cut(s) 353, 618, 727
CviAII CATG 4 cut(s) 101, 107, 779, 844
CviQI GTAC 3 cut(s) 353, 618, 727
DdeI CTNAG 4 cut(s) 69, 222, 236, 649
DpnI GATC 2 cut(s) 569, 777
DpnII GATC 2 cut(s) 567, 775
DraIII CACNNNGTG 1 cut(s) 28
Eam1104I CTCTTC 2 cut(s) 705, 732
EarI CTCTTC 2 cut(s) 705, 732
Eco47I GGWCC 1 cut(s) 292
Eco57I CTGAAG 2 cut(s) 591, 729
EcoO109I RGGNCCY 1 cut(s) 292
EcoRII CCWGG 1 cut(s) 355
FaeI CATG 4 cut(s) 104, 110, 782, 847
FalI AAGNNNNNCTT 4 cut(s) 368, 400, 850, 882
FaqI GGGAC 2 cut(s) 305, 644
FatI CATG 4 cut(s) 100, 106, 778, 843
FbaI TGATCA 1 cut(s) 775
FokI GGATG 2 cut(s) 169, 300
FspBI CTAG 3 cut(s) 456, 872, 883
GlaI GCGC 1 cut(s) 488
HapII CCGG 1 cut(s) 279
HgaI GACGC 1 cut(s) 602
HhaI GCGC 1 cut(s) 489
Hin1II CATG 4 cut(s) 104, 110, 782, 847
Hin6I GCGC 1 cut(s) 487
HinP1I GCGC 1 cut(s) 487
HincII GTYRAC 1 cut(s) 440
HindII GTYRAC 1 cut(s) 440
HpaII CCGG 1 cut(s) 279
HphI GGTGA 1 cut(s) 20
Hpy166II GTNNAC 2 cut(s) 440, 523
Hpy188I TCNGA 5 cut(s) 262, 322, 478, 572, 610
Hpy188III TCNNGA 2 cut(s) 251, 533
Hpy8I GTNNAC 2 cut(s) 440, 523
Hpy99I CGWCG 1 cut(s) 618
HpyAV CCTTC 3 cut(s) 71, 615, 852
HpyCH4III ACNGT 2 cut(s) 205, 310
HpyCH4V TGCA 6 cut(s) 31, 100, 127, 302, 317, 748
HpyF10VI GCNNNNNNNGC 1 cut(s) 872
HpyF3I CTNAG 4 cut(s) 69, 222, 236, 649
Hsp92II CATG 4 cut(s) 104, 110, 782, 847
HspAI GCGC 1 cut(s) 487
KflI GGGWCCC 1 cut(s) 292
Ksp22I TGATCA 1 cut(s) 775
Kzo9I GATC 2 cut(s) 567, 775
LmnI GCTCC 2 cut(s) 604, 687
LpnPI CCDG 5 cut(s) 292, 342, 369, 420, 473
LweI GCATC 1 cut(s) 326
MaeI CTAG 3 cut(s) 456, 872, 883
MaeIII GTNAC 4 cut(s) 8, 310, 509, 589
MalI GATC 2 cut(s) 569, 777
MboI GATC 2 cut(s) 567, 775
MboII GAAGA 2 cut(s) 722, 749
MluCI AATT 7 cut(s) 32, 83, 150, 254, 472, 654, 750
MmeI TCCRAC 1 cut(s) 709
MnlI CCTC 8 cut(s) 316, 463, 477, 532, 566, 589, 819, 822
MseI TTAA 3 cut(s) 345, 552, 792
MslI CAYNNNNRTG 1 cut(s) 105
MspI CCGG 1 cut(s) 279
MspR9I CCNGG 1 cut(s) 357
MvaI CCWGG 1 cut(s) 357
MvnI CGCG 1 cut(s) 489
MwoI GCNNNNNNNGC 1 cut(s) 872
NdeII GATC 2 cut(s) 567, 775
NheI GCTAGC 1 cut(s) 871
NlaIII CATG 4 cut(s) 104, 110, 782, 847
NlaIV GGNNCC 3 cut(s) 293, 294, 600
NmuCI GTSAC 2 cut(s) 8, 589
NspI RCATGY 1 cut(s) 110
PpuMI RGGWCCY 1 cut(s) 292
Psp5II RGGWCCY 1 cut(s) 292
Psp6I CCWGG 1 cut(s) 355
PspGI CCWGG 1 cut(s) 355
PspN4I GGNNCC 3 cut(s) 293, 294, 600
PspPI GGNCC 1 cut(s) 292
PspPPI RGGWCCY 1 cut(s) 292
RsaI GTAC 3 cut(s) 354, 619, 728
RsaNI GTAC 3 cut(s) 353, 618, 727
RseI CAYNNNNRTG 1 cut(s) 105
SaqAI TTAA 3 cut(s) 345, 552, 792
Sau3AI GATC 2 cut(s) 567, 775
Sau96I GGNCC 1 cut(s) 292
ScaI AGTACT 1 cut(s) 728
ScrFI CCNGG 1 cut(s) 357
SetI ASST 5 cut(s) 589, 607, 684, 868, 877
SfaNI GCATC 1 cut(s) 326
SfcI CTRYAG 1 cut(s) 370
SinI GGWCC 1 cut(s) 292
SmiMI CAYNNNNRTG 1 cut(s) 105
SmlI CTYRAG 1 cut(s) 215
SmoI CTYRAG 1 cut(s) 215
Sse9I AATT 7 cut(s) 32, 83, 150, 254, 472, 654, 750
SspI AATATT 1 cut(s) 414
SspMI CTAG 3 cut(s) 456, 872, 883
StyD4I CCNGG 1 cut(s) 355
TaaI ACNGT 2 cut(s) 205, 310
TaqI TCGA 1 cut(s) 546
TasI AATT 7 cut(s) 32, 83, 150, 254, 472, 654, 750
TatI WGTACW 1 cut(s) 726
Tru1I TTAA 3 cut(s) 345, 552, 792
Tru9I TTAA 3 cut(s) 345, 552, 792
TscAI CASTG 2 cut(s) 208, 313
TseFI GTSAC 2 cut(s) 8, 589
Tsp45I GTSAC 2 cut(s) 8, 589
TspDTI ATGAA 6 cut(s) 76, 90, 206, 411, 686, 867
TspRI CASTG 2 cut(s) 208, 313
VpaK11BI GGWCC 1 cut(s) 292
XapI RAATTY 4 cut(s) 83, 150, 254, 654
XceI RCATGY 1 cut(s) 110
XspI CTAG 3 cut(s) 456, 872, 883
ZrmI AGTACT 1 cut(s) 728
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.