Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000001

Orthogroup ID

OG0001153

Physical Location & Seq

Genomic Coordinates Forward (+)

5134216 .. 5136568

Gene Structure 2353 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_1G00003860.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 570 bp

ATGGCCTCTAATGAAGTGGAGATTGATGATAAAGCTGAATGGTCTACTAAGAATGAAGGAAAATTTATTCGTATTTTGCATGAGCATGTGAAAAAAGGAGATATGCAAACATCCACTTTCAAAAAGAAAATTTGGACTGAAATAAGTGATGAGTTGTTTGTTGAAACTACGAAAAGATACACTGTGGCACAACTCAAGTCTAAGTTCAATAGACTACGCAAAAAACACCGTGAATTTTCTGATTTGATTGAGCATACTGGATTTGGATGGGACCCTATTGCAAACACTCATACTGCATCGAGGAAGTATGGGCTACTTATATTAAGAGAGTACGGAGTGAAGCCCTATCGTAAGAAAGGCTTGGAACATTATGAAACGTTAGGGGAAATATTCAATACTACTACCGCAACGGGTCAACTACATTATGCCTCTAGCCAGCTCCCTCCCAATTCAGATGATGAGCGCGAGTTAGAGAATAAGTTTCTTAACAATGGAGTTCACATCAATCTTGATGAGGATTTCAATGTTAATAATACTCAAAATGAGATCAGAGGAAAAGAAAAGCTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Myb_DNA-bind_3

Protein Analysis

189

Amino Acids

22.09

Weight (kDa)

7.11

Isoelectric Point (pI)

23.92

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Myb_DNA-bind_3	PF12776	13 - 101	7.7e-17	Myb/SANT-like DNA-binding domain
Myb_DNA-bind_4	PF13837	13 - 81	5.2e-07	Myb/SANT-like DNA-binding domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001153)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g13820 FvH4_4g13820 FvH4_7g00340 FvH4_7g00340
malus_domestica	MD03G1270400.v1.1
prunus_persica	Prupe.2G094900_v2.0.a1 Prupe.2G102600_v2.0.a1 Prupe.6G193000_v2.0.a1 Prupe.7G061200_v2.0.a1 Prupe.7G061200_v2.0.a1 Prupe.7G061200_v2.0.a1 Prupe.8G054800_v2.0.a1 Prupe.8G117400_v2.0.a1
pyrus_communis	pycom03g21560 pycom07g16360
rosa_chinensis	RchiOBHm_Chr1g0354771
rosa_laevigata	RLG00000001198 RLG00000008665 RLG00000013335 RLG00000015409 RLG00000034319 RLG00000035605
rosa_multiflora	Rmu_sc0001706.1_g000015 Rmu_sc0002322.1_g000017 Rmu_sc0003547.1_g000003 Rmu_sc0004100.1_g000005 Rmu_sc0005327.1_g000016 Rmu_sc0005391.1_g000008 Rmu_sc0005712.1_g000024 Rmu_sc0005828.1_g000009 Rmu_sc0007671.1_g000018
rosa_roxburghii	Rroxscaffold_1G00003860 Rroxscaffold_1G00034960 Rroxscaffold_2G00132460 Rroxscaffold_2G00138020 Rroxscaffold_3G00226530 Rroxscaffold_3G00263690 Rroxscaffold_5G00349740 Rroxscaffold_6G00420740 Rroxscaffold_7G00189380
rosa_rugosa	Rorug01G0229200 Rorug07G0196300
rosa_samantha	Rh2CG067600 Rh4BG064700 Rh4BG219300 Rh4BG219400 Rh4DG015000 Rh4DG015100 Rh5DG120300 Rh5DG242700 Rh5DG449200 Rh7BG129400 Rh7DG459200
rosa_wichuraiana	Rw4G033640 Rw5G021850 Rw6G008400 Rw6G017680 Rw7G041100

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	44
AccII	CGCG	1 cut(s)	465
AciI	CCGC	1 cut(s)	405
AclI	AACGTT	1 cut(s)	377
AcsI	RAATTY	3 cut(s)	62, 129, 233
AfaI	GTAC	1 cut(s)	332
AgsI	TTSAA	5 cut(s)	121, 164, 208, 394, 523
AluBI	AGCT	3 cut(s)	35, 439, 565
AluI	AGCT	3 cut(s)	35, 439, 565
AoxI	GGCC	1 cut(s)	3
ApoI	RAATTY	3 cut(s)	62, 129, 233
AspLEI	GCGC	1 cut(s)	465
AspS9I	GGNCC	1 cut(s)	271
AvaII	GGWCC	1 cut(s)	271
BccI	CCATC	1 cut(s)	261
BfaI	CTAG	1 cut(s)	432
Bme18I	GGWCC	1 cut(s)	271
BmgT120I	GGNCC	1 cut(s)	271
BmiI	GGNNCC	2 cut(s)	272, 273
BmsI	GCATC	1 cut(s)	305
BpuEI	CTTGAG	1 cut(s)	179
Bse1I	ACTGG	1 cut(s)	262
BseGI	GGATG	2 cut(s)	110, 272
BseNI	ACTGG	1 cut(s)	262
Bsh1236I	CGCG	1 cut(s)	465
BshFI	GGCC	1 cut(s)	5
BslFI	GGGAC	1 cut(s)	284
BsmFI	GGGAC	1 cut(s)	284
BsnI	GGCC	1 cut(s)	5
Bsp143I	GATC	1 cut(s)	546
BspACI	CCGC	1 cut(s)	405
BspANI	GGCC	1 cut(s)	5
BspFNI	CGCG	1 cut(s)	465
BspLI	GGNNCC	2 cut(s)	272, 273
BsrI	ACTGG	1 cut(s)	262
BssMI	GATC	1 cut(s)	546
Bst4CI	ACNGT	2 cut(s)	184, 230
BstC8I	GCNNGC	1 cut(s)	437
BstDEI	CTNAG	2 cut(s)	48, 201
BstF5I	GGATG	2 cut(s)	110, 272
BstFNI	CGCG	1 cut(s)	465
BstHHI	GCGC	1 cut(s)	465
BstKTI	GATC	1 cut(s)	549
BstMBI	GATC	1 cut(s)	546
BstNSI	RCATGY	1 cut(s)	89
BstUI	CGCG	1 cut(s)	465
BsuRI	GGCC	1 cut(s)	5
BtsCI	GGATG	2 cut(s)	110, 272
BtsIMutI	CAGTG	1 cut(s)	180
Cac8I	GCNNGC	1 cut(s)	437
CfoI	GCGC	1 cut(s)	465
Cfr13I	GGNCC	1 cut(s)	271
Csp6I	GTAC	1 cut(s)	331
CviAII	CATG	2 cut(s)	80, 86
CviJI	RGCY	8 cut(s)	5, 35, 313, 343, 360, 435, 439, 565
CviKI_1	RGCY	8 cut(s)	5, 35, 313, 343, 360, 435, 439, 565
CviQI	GTAC	1 cut(s)	331
DdeI	CTNAG	2 cut(s)	48, 201
DpnI	GATC	1 cut(s)	548
DpnII	GATC	1 cut(s)	546
Eco47I	GGWCC	1 cut(s)	271
EcoO109I	RGGNCCY	1 cut(s)	271
FaeI	CATG	2 cut(s)	83, 89
FaiI	YATR	9 cut(s)	81, 87, 104, 255, 291, 309, 320, 372, 426
FalI	AAGNNNNNCTT	2 cut(s)	344, 376
FaqI	GGGAC	1 cut(s)	284
FatI	CATG	2 cut(s)	79, 85
FblI	GTMKAC	1 cut(s)	44
FokI	GGATG	2 cut(s)	97, 279
FspBI	CTAG	1 cut(s)	432
GlaI	GCGC	1 cut(s)	464
HaeIII	GGCC	1 cut(s)	5
HhaI	GCGC	1 cut(s)	465
Hin1II	CATG	2 cut(s)	83, 89
Hin6I	GCGC	1 cut(s)	463
HinP1I	GCGC	1 cut(s)	463
HincII	GTYRAC	1 cut(s)	416
HindII	GTYRAC	1 cut(s)	416
Hpy166II	GTNNAC	3 cut(s)	45, 416, 499
Hpy188I	TCNGA	3 cut(s)	241, 454, 551
Hpy188III	TCNNGA	1 cut(s)	509
Hpy8I	GTNNAC	3 cut(s)	45, 416, 499
HpyAV	CCTTC	1 cut(s)	50
HpyCH4III	ACNGT	2 cut(s)	184, 230
HpyCH4IV	ACGT	1 cut(s)	377
HpyCH4V	TGCA	4 cut(s)	79, 106, 281, 296
HpyF3I	CTNAG	2 cut(s)	48, 201
HpySE526I	ACGT	1 cut(s)	377
Hsp92II	CATG	2 cut(s)	83, 89
HspAI	GCGC	1 cut(s)	463
KflI	GGGWCCC	1 cut(s)	271
Kzo9I	GATC	1 cut(s)	546
LmnI	GCTCC	1 cut(s)	444
LpnPI	CCDG	2 cut(s)	243, 449
LweI	GCATC	1 cut(s)	305
MaeI	CTAG	1 cut(s)	432
MaeII	ACGT	1 cut(s)	377
MalI	GATC	1 cut(s)	548
MboI	GATC	1 cut(s)	546
MluCI	AATT	4 cut(s)	62, 129, 233, 448
MnlI	CCTC	6 cut(s)	16, 294, 439, 453, 508, 545
MseI	TTAA	3 cut(s)	323, 486, 528
MslI	CAYNNNNRTG	1 cut(s)	84
MvnI	CGCG	1 cut(s)	465
NdeII	GATC	1 cut(s)	546
NlaIII	CATG	2 cut(s)	83, 89
NlaIV	GGNNCC	2 cut(s)	272, 273
NspI	RCATGY	1 cut(s)	89
PpuMI	RGGWCCY	1 cut(s)	271
Psp1406I	AACGTT	1 cut(s)	377
Psp5II	RGGWCCY	1 cut(s)	271
PspN4I	GGNNCC	2 cut(s)	272, 273
PspPI	GGNCC	1 cut(s)	271
PspPPI	RGGWCCY	1 cut(s)	271
RsaI	GTAC	1 cut(s)	332
RsaNI	GTAC	1 cut(s)	331
RseI	CAYNNNNRTG	1 cut(s)	84
SaqAI	TTAA	3 cut(s)	323, 486, 528
Sau3AI	GATC	1 cut(s)	546
Sau96I	GGNCC	1 cut(s)	271
SetI	ASST	4 cut(s)	37, 380, 441, 567
SfaNI	GCATC	1 cut(s)	305
SinI	GGWCC	1 cut(s)	271
SmiMI	CAYNNNNRTG	1 cut(s)	84
SmlI	CTYRAG	1 cut(s)	194
SmoI	CTYRAG	1 cut(s)	194
Sse9I	AATT	4 cut(s)	62, 129, 233, 448
SsiI	CCGC	1 cut(s)	405
SspI	AATATT	1 cut(s)	390
SspMI	CTAG	1 cut(s)	432
TaaI	ACNGT	2 cut(s)	184, 230
TaiI	ACGT	1 cut(s)	380
TaqI	TCGA	1 cut(s)	299
TasI	AATT	4 cut(s)	62, 129, 233, 448
Tru1I	TTAA	3 cut(s)	323, 486, 528
Tru9I	TTAA	3 cut(s)	323, 486, 528
TscAI	CASTG	1 cut(s)	187
TspDTI	ATGAA	3 cut(s)	27, 69, 387
TspGWI	ACGGA	1 cut(s)	348
TspRI	CASTG	1 cut(s)	187
VpaK11BI	GGWCC	1 cut(s)	271
XapI	RAATTY	3 cut(s)	62, 129, 233
XceI	RCATGY	1 cut(s)	89
XmiI	GTMKAC	1 cut(s)	44
XspI	CTAG	1 cut(s)	432

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.