pycom01g07670
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
8632279 .. 8632807
529 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g07670.2

Sequence Viewer

Length: 357 bp
ATGATGAGATCCACCCCTATTAAAGAAAGTTGGATTCTGCATGATTGGAGCGATGAAGAAAGTATGAAGATATTGAGTAAGTGTAGAGAAGCAATACTTCTGAGCAAAAACGACAAAGGGAATAAGAAGATTATCATCATAGACATAGTTGTGGGACATGTCGATAACAAGGAGAAGATGGTGGATAAGAAATCAATTGAAACCCAACTGATGTTCGATATGTTGATGATGTCTACTGCCACTGGCAAAGAGCGTAGCGAATCAGAATGGAAAACAATCTTTTTGGTTGCTGGTTTTACTTACTATAATATCACTCATACATTCGATTTCAGGTCTCTTATTGAACTTTACCTTTGA

Protein Analysis

119

Amino Acids

13.86

Weight (kDa)

6.29

Isoelectric Point (pI)

47.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000692)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g26800 FvH4_6g26810
malus_domestica MD01G1048000.v1.1 MD01G1048300.v1.1 MD01G1048400.v1.1 MD01G1051800.v1.1 MD01G1051900.v1.1 MD01G1149300.v1.1
prunus_persica Prupe.3G118900_v2.0.a1 Prupe.3G119100_v2.0.a1 Prupe.3G119700_v2.0.a1 Prupe.3G119800_v2.0.a1 Prupe.3G120200_v2.0.a1 Prupe.3G120400_v2.0.a1 Prupe.3G127600_v2.0.a1 Prupe.3G129000_v2.0.a1 Prupe.3G129200_v2.0.a1 Prupe.3G129400_v2.0.a1 Prupe.3G129600_v2.0.a1 Prupe.3G129800_v2.0.a1 Prupe.4G252900_v2.0.a1 Prupe.4G253200_v2.0.a1 Prupe.4G253300_v2.0.a1
pyrus_communis pycom01g07360 pycom01g07640 pycom01g07670 pycom01g07720 pycom01g07740 pycom01g07750
rosa_chinensis RchiOBHm_Chr2g0119291 RchiOBHm_Chr2g0123081 RchiOBHm_Chr2g0123091 RchiOBHm_Chr2g0128091 RchiOBHm_Chr2g0128121 RchiOBHm_Chr2g0128161 RchiOBHm_Chr4g0436611
rosa_laevigata RLG00000006507 RLG00000006508 RLG00000018994 RLG00000018995
rosa_multiflora Rmu_co8289337.1_g000001 Rmu_sc0000837.1_g000001 Rmu_sc0003130.1_g000011 Rmu_sc0027975.1_g000001
rosa_roxburghii Rroxscaffold_2G00115570 Rroxscaffold_2G00115600 Rroxscaffold_2G00116080 Rroxscaffold_2G00116090 Rroxscaffold_5G00377660
rosa_rugosa Rorug02G0278000 Rorug02G0278000 Rorug02G0278100 Rorug02G0558700 Rorug04G0294700
rosa_samantha Rh2AG330000 Rh2AG330300 Rh2AG330500 Rh2AG330600 Rh2AG330900 Rh2AG331100 Rh2BG310500 Rh2BG339200 Rh2BG339300 Rh2CG316800 Rh2DG304600 Rh2DG356000 Rh2DG356200 Rh4AG349100 Rh4BG357800 Rh4CG372300 Rh4DG352000 Rh5BG070000
rosa_wichuraiana Rw2G026730 Rw2G026760 Rw4G030540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 233
AclWI GGATC 1 cut(s) 3
AflIII ACRYGT 1 cut(s) 157
AgsI TTSAA 2 cut(s) 200, 344
Alw26I GTCTC 1 cut(s) 339
AlwI GGATC 1 cut(s) 3
BccI CCATC 1 cut(s) 172
BcoDI GTCTC 1 cut(s) 339
BsaBI GATNNNNATC 1 cut(s) 134
BsaI GGTCTC 1 cut(s) 339
Bse1I ACTGG 1 cut(s) 247
Bse8I GATNNNNATC 1 cut(s) 134
BseJI GATNNNNATC 1 cut(s) 134
BseMII CTCAG 1 cut(s) 92
BseNI ACTGG 1 cut(s) 247
BslFI GGGAC 1 cut(s) 168
BsmAI GTCTC 1 cut(s) 339
BsmFI GGGAC 1 cut(s) 168
Bso31I GGTCTC 1 cut(s) 339
Bsp143I GATC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 93
BspPI GGATC 1 cut(s) 3
BspTNI GGTCTC 1 cut(s) 339
BsrI ACTGG 1 cut(s) 247
BssMI GATC 1 cut(s) 8
BstDEI CTNAG 1 cut(s) 101
BstKTI GATC 1 cut(s) 11
BstMAI GTCTC 1 cut(s) 339
BstMBI GATC 1 cut(s) 8
BstNSI RCATGY 1 cut(s) 161
BstX2I RGATCY 1 cut(s) 8
BstYI RGATCY 1 cut(s) 8
BtgZI GCGATG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 240
CviAII CATG 2 cut(s) 41, 158
DdeI CTNAG 1 cut(s) 101
DpnI GATC 1 cut(s) 10
DpnII GATC 1 cut(s) 8
Eco31I GGTCTC 1 cut(s) 339
FaeI CATG 2 cut(s) 44, 161
FaiI YATR 8 cut(s) 42, 65, 140, 146, 159, 221, 306, 318
FalI AAGNNNNNCTT 2 cut(s) 81, 113
FaqI GGGAC 1 cut(s) 168
FatI CATG 2 cut(s) 40, 157
FblI GTMKAC 1 cut(s) 233
Hin1II CATG 2 cut(s) 44, 161
HinfI GANTC 2 cut(s) 34, 260
Hpy166II GTNNAC 1 cut(s) 234
Hpy188I TCNGA 2 cut(s) 102, 265
Hpy8I GTNNAC 1 cut(s) 234
HpyCH4V TGCA 1 cut(s) 40
HpyF3I CTNAG 1 cut(s) 101
Hsp92II CATG 2 cut(s) 44, 161
Kzo9I GATC 1 cut(s) 8
LmnI GCTCC 1 cut(s) 48
LpnPI CCDG 3 cut(s) 228, 276, 316
MalI GATC 1 cut(s) 10
MboI GATC 1 cut(s) 8
MboII GAAGA 4 cut(s) 68, 79, 139, 187
MfeI CAATTG 1 cut(s) 195
MflI RGATCY 1 cut(s) 8
MluCI AATT 1 cut(s) 195
MmeI TCCRAC 1 cut(s) 11
MseI TTAA 1 cut(s) 21
MslI CAYNNNNRTG 1 cut(s) 149
MunI CAATTG 1 cut(s) 195
NdeII GATC 1 cut(s) 8
NlaIII CATG 2 cut(s) 44, 161
NspI RCATGY 1 cut(s) 161
PciI ACATGT 1 cut(s) 157
PfeI GAWTC 2 cut(s) 34, 260
PscI ACATGT 1 cut(s) 157
PsuI RGATCY 1 cut(s) 8
RseI CAYNNNNRTG 1 cut(s) 149
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 1 cut(s) 8
SetI ASST 2 cut(s) 335, 354
SgeI CNNG 6 cut(s) 53, 170, 181, 255, 303, 343
SmiMI CAYNNNNRTG 1 cut(s) 149
Sse9I AATT 1 cut(s) 195
TaqI TCGA 3 cut(s) 162, 216, 324
TasI AATT 1 cut(s) 195
TfiI GAWTC 2 cut(s) 34, 260
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TscAI CASTG 1 cut(s) 247
TspDTI ATGAA 2 cut(s) 69, 80
TspRI CASTG 1 cut(s) 247
XceI RCATGY 1 cut(s) 161
XmiI GTMKAC 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.