Rmu_sc0003130.1_g000011
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003130.1
Physical Location & Seq
Reverse (-)
56376 .. 57571
1196 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003130.1_g000011.1.cds

Sequence Viewer

Length: 1080 bp
atggatttagctattaataatagtagttctcgtgagcttcttcaagctcaagtccatgtttggaatcacatattgaagttcataaactccatggcactaaaatgtgcaattcagttaggcattccagatatcattcacaaccatggccaacccattaccctctccaaccttatttctagactcaatgtccacccttctaaatctcgcttcatctatcgcctcatgcgcattttagtccaatgtggattttttgtcaaacataacgacgttcatcaagaagtagtctattccctgacaccatcttccgagcttctcctcaatgaccagcctttgaaaatgacaccgttcttgcttctcctactcgacccaatgttgattgccccgttgcacttgttgggctcgtggttccgaaaacacggatccaccccatttgagatgacatatgatatgtcgttcttcgatttgggggctcatgaaccaaggtttggtagcatgtttgacgaagcaatggctgccgactcggagcttgtttcgagggtggtgattaaagagtgtcaaggagtgtttgagggtttgaattcaattgttgatgtcggaggtggtagaggaactatggcttttgccattgccaatgcatttccacacataaaatgcactgtattggatctcccacatgtcattgataacttgaaagggaccaacaacttggattttgttgtcggagacatgtttgagaaaatacccccagcaaatgcaattttactcaagtggattctgcatgactggaatgatgaagaaagcgtgaagatattgaagaggtgtagagaagcagtttcgatcagcaaaagtgacagaggaaaggttatcattatagacatcgttgtaaccgtagataacaaggagatgaataacaggtcaactgaaacacaactgttatgggacatgttgatgatggtgaatctcactggaagagaacgcactgaaaaagagtgggagaagctgtttttggctgcaggattcacttactataagatttcacatacactgggagttaggtctcttattgaggtttacctttga

Protein Analysis

359

Amino Acids

40.77

Weight (kDa)

6.27

Isoelectric Point (pI)

33.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000692)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g26800 FvH4_6g26810
malus_domestica MD01G1048000.v1.1 MD01G1048300.v1.1 MD01G1048400.v1.1 MD01G1051800.v1.1 MD01G1051900.v1.1 MD01G1149300.v1.1
prunus_persica Prupe.3G118900_v2.0.a1 Prupe.3G119100_v2.0.a1 Prupe.3G119700_v2.0.a1 Prupe.3G119800_v2.0.a1 Prupe.3G120200_v2.0.a1 Prupe.3G120400_v2.0.a1 Prupe.3G127600_v2.0.a1 Prupe.3G129000_v2.0.a1 Prupe.3G129200_v2.0.a1 Prupe.3G129400_v2.0.a1 Prupe.3G129600_v2.0.a1 Prupe.3G129800_v2.0.a1 Prupe.4G252900_v2.0.a1 Prupe.4G253200_v2.0.a1 Prupe.4G253300_v2.0.a1
pyrus_communis pycom01g07360 pycom01g07640 pycom01g07670 pycom01g07720 pycom01g07740 pycom01g07750
rosa_chinensis RchiOBHm_Chr2g0119291 RchiOBHm_Chr2g0123081 RchiOBHm_Chr2g0123091 RchiOBHm_Chr2g0128091 RchiOBHm_Chr2g0128121 RchiOBHm_Chr2g0128161 RchiOBHm_Chr4g0436611
rosa_laevigata RLG00000006507 RLG00000006508 RLG00000018994 RLG00000018995
rosa_multiflora Rmu_co8289337.1_g000001 Rmu_sc0000837.1_g000001 Rmu_sc0003130.1_g000011 Rmu_sc0027975.1_g000001
rosa_roxburghii Rroxscaffold_2G00115570 Rroxscaffold_2G00115600 Rroxscaffold_2G00116080 Rroxscaffold_2G00116090 Rroxscaffold_5G00377660
rosa_rugosa Rorug02G0278000 Rorug02G0278000 Rorug02G0278100 Rorug02G0558700 Rorug04G0294700
rosa_samantha Rh2AG330000 Rh2AG330300 Rh2AG330500 Rh2AG330600 Rh2AG330900 Rh2AG331100 Rh2BG310500 Rh2BG339200 Rh2BG339300 Rh2CG316800 Rh2DG304600 Rh2DG356000 Rh2DG356200 Rh4AG349100 Rh4BG357800 Rh4CG372300 Rh4DG352000 Rh5BG070000
rosa_wichuraiana Rw2G026730 Rw2G026760 Rw4G030540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 227
AccB7I CCANNNNNTGG 1 cut(s) 485
AclWI GGATC 3 cut(s) 414, 427, 672
AcoI YGGCCR 1 cut(s) 145
AcsI RAATTY 1 cut(s) 577
AfiI CCNNNNNNNGG 1 cut(s) 485
AflIII ACRYGT 3 cut(s) 673, 726, 942
AgsI TTSAA 7 cut(s) 44, 76, 334, 577, 582, 691, 814
AhdI GACNNNNNGTC 1 cut(s) 185
AjuI GAANNNNNNNTTGG 4 cut(s) 468, 500, 989, 1021
AluBI AGCT 6 cut(s) 11, 37, 47, 310, 526, 1000
AluI AGCT 6 cut(s) 11, 37, 47, 310, 526, 1000
Alw26I GTCTC 2 cut(s) 717, 1062
AlwI GGATC 3 cut(s) 414, 427, 672
AoxI GGCC 1 cut(s) 145
ApeKI GCWGC 2 cut(s) 512, 1010
ApoI RAATTY 1 cut(s) 577
AseI ATTAAT 1 cut(s) 15
AspLEI GCGC 1 cut(s) 228
AspS9I GGNCC 1 cut(s) 696
AsuHPI GGTGA 2 cut(s) 553, 967
AvaII GGWCC 1 cut(s) 696
BalI TGGCCA 1 cut(s) 147
BamHI GGATCC 1 cut(s) 419
BanII GRGCYC 2 cut(s) 401, 472
BauI CACGAG 2 cut(s) 30, 400
BbvI GCAGC 2 cut(s) 499, 997
BccI CCATC 2 cut(s) 307, 946
BcoDI GTCTC 2 cut(s) 717, 1062
BfaI CTAG 1 cut(s) 177
BfmI CTRYAG 1 cut(s) 1011
BisI GCNGC 2 cut(s) 513, 1011
BlsI GCNGC 2 cut(s) 514, 1012
Bme18I GGWCC 1 cut(s) 696
BmeRI GACNNNNNGTC 1 cut(s) 185
BmgT120I GGNCC 1 cut(s) 696
BmiI GGNNCC 3 cut(s) 407, 421, 697
BmrI ACTGGG 1 cut(s) 1055
BmuI ACTGGG 1 cut(s) 1055
BpuEI CTTGAG 2 cut(s) 33, 749
BsaI GGTCTC 1 cut(s) 1062
BsaJI CCNNGG 3 cut(s) 90, 142, 479
BsaXI ACNNNNNCTCC 2 cut(s) 986, 1016
Bsc4I CCNNNNNNNGG 1 cut(s) 485
Bse1I ACTGG 3 cut(s) 788, 970, 1050
Bse3DI GCAATG 2 cut(s) 513, 624
BseDI CCNNGG 3 cut(s) 90, 142, 479
BseLI CCNNNNNNNGG 1 cut(s) 485
BseMI GCAATG 2 cut(s) 513, 624
BseNI ACTGG 3 cut(s) 788, 970, 1050
BseRI GAGGAG 1 cut(s) 305
BseXI GCAGC 2 cut(s) 499, 997
BseYI CCCAGC 1 cut(s) 745
BshFI GGCC 1 cut(s) 147
BslFI GGGAC 2 cut(s) 709, 953
BslI CCNNNNNNNGG 1 cut(s) 485
BsmAI GTCTC 2 cut(s) 717, 1062
BsmFI GGGAC 2 cut(s) 709, 953
BsmI GAATGC 1 cut(s) 120
BsnI GGCC 1 cut(s) 147
Bso31I GGTCTC 1 cut(s) 1062
Bsp1286I GDGCHC 2 cut(s) 401, 472
Bsp143I GATC 3 cut(s) 419, 664, 837
Bsp19I CCATGG 2 cut(s) 90, 142
BspANI GGCC 1 cut(s) 147
BspHI TCATGA 1 cut(s) 472
BspLI GGNNCC 3 cut(s) 407, 421, 697
BspMAI CTGCAG 1 cut(s) 1015
BspPI GGATC 3 cut(s) 414, 427, 672
BspTNI GGTCTC 1 cut(s) 1062
BsrDI GCAATG 2 cut(s) 513, 624
BsrI ACTGG 3 cut(s) 788, 970, 1050
BssECI CCNNGG 3 cut(s) 90, 142, 479
BssMI GATC 3 cut(s) 419, 664, 837
BssSI CACGAG 2 cut(s) 30, 400
BssT1I CCWWGG 3 cut(s) 90, 142, 479
Bst2BI CACGAG 2 cut(s) 30, 400
Bst4CI ACNGT 4 cut(s) 345, 658, 889, 933
Bst6I CTCTTC 2 cut(s) 809, 964
BstAPI GCANNNNNTGC 1 cut(s) 512
BstDSI CCRYGG 2 cut(s) 90, 142
BstHHI GCGC 1 cut(s) 228
BstKTI GATC 3 cut(s) 422, 667, 840
BstMAI GTCTC 2 cut(s) 717, 1062
BstMBI GATC 3 cut(s) 419, 664, 837
BstMWI GCNNNNNNNGC 2 cut(s) 225, 512
BstNSI RCATGY 4 cut(s) 496, 677, 730, 946
BstSFI CTRYAG 1 cut(s) 1011
BstV1I GCAGC 2 cut(s) 499, 997
BstX2I RGATCY 2 cut(s) 419, 664
BstXI CCANNNNNNTGG 1 cut(s) 706
BstYI RGATCY 2 cut(s) 419, 664
BsuRI GGCC 1 cut(s) 147
BtgI CCRYGG 2 cut(s) 90, 142
BtsIMutI CAGTG 4 cut(s) 654, 963, 978, 1043
CciI TCATGA 1 cut(s) 472
CfoI GCGC 1 cut(s) 228
Cfr13I GGNCC 1 cut(s) 696
CspCI CAANNNNNGTGG 2 cut(s) 412, 447
DpnI GATC 3 cut(s) 421, 666, 839
DpnII GATC 3 cut(s) 419, 664, 837
DriI GACNNNNNGTC 1 cut(s) 185
EaeI YGGCCR 1 cut(s) 145
Eam1104I CTCTTC 2 cut(s) 809, 964
Eam1105I GACNNNNNGTC 1 cut(s) 185
EarI CTCTTC 2 cut(s) 809, 964
Eco130I CCWWGG 3 cut(s) 90, 142, 479
Eco24I GRGCYC 2 cut(s) 401, 472
Eco31I GGTCTC 1 cut(s) 1062
Eco32I GATATC 1 cut(s) 130
Eco47I GGWCC 1 cut(s) 696
EcoRI GAATTC 1 cut(s) 577
EcoRV GATATC 1 cut(s) 130
EcoT14I CCWWGG 3 cut(s) 90, 142, 479
EcoT22I ATGCAT 1 cut(s) 637
EcoT38I GRGCYC 2 cut(s) 401, 472
ErhI CCWWGG 3 cut(s) 90, 142, 479
FaqI GGGAC 2 cut(s) 709, 953
FauNDI CATATG 1 cut(s) 442
Fnu4HI GCNGC 2 cut(s) 513, 1011
FriOI GRGCYC 2 cut(s) 401, 472
Fsp4HI GCNGC 2 cut(s) 513, 1011
FspAI RTGCGCAY 1 cut(s) 227
FspBI CTAG 1 cut(s) 177
FspI TGCGCA 1 cut(s) 227
GlaI GCGC 1 cut(s) 227
GluI GCNGC 2 cut(s) 513, 1011
GsaI CCCAGC 1 cut(s) 749
HaeIII GGCC 1 cut(s) 147
HhaI GCGC 1 cut(s) 228
Hin6I GCGC 1 cut(s) 226
HinP1I GCGC 1 cut(s) 226
HincII GTYRAC 1 cut(s) 918
HindII GTYRAC 1 cut(s) 918
HinfI GANTC 6 cut(s) 64, 180, 518, 772, 958, 1017
HphI GGTGA 2 cut(s) 553, 967
Hpy166II GTNNAC 3 cut(s) 190, 918, 1072
Hpy188I TCNGA 5 cut(s) 307, 410, 523, 596, 722
Hpy188III TCNNGA 5 cut(s) 32, 125, 177, 275, 473
Hpy8I GTNNAC 3 cut(s) 190, 918, 1072
Hpy99I CGWCG 1 cut(s) 269
HpyAV CCTTC 1 cut(s) 204
HpyCH4III ACNGT 4 cut(s) 345, 658, 889, 933
HpyCH4IV ACGT 1 cut(s) 267
HpyCH4V TGCA 7 cut(s) 107, 388, 635, 654, 755, 778, 1013
HpyF10VI GCNNNNNNNGC 2 cut(s) 225, 512
HpySE526I ACGT 1 cut(s) 267
HspAI GCGC 1 cut(s) 226
Kzo9I GATC 3 cut(s) 419, 664, 837
LmnI GCTCC 1 cut(s) 523
LpnPI CCDG 9 cut(s) 138, 305, 338, 759, 769, 898, 951, 999, 1031
Lsp1109I GCAGC 2 cut(s) 499, 997
MaeI CTAG 1 cut(s) 177
MaeII ACGT 1 cut(s) 267
MaeIII GTNAC 2 cut(s) 848, 883
MalI GATC 3 cut(s) 421, 666, 839
MboI GATC 3 cut(s) 419, 664, 837
MboII GAAGA 7 cut(s) 32, 294, 448, 806, 817, 826, 981
MfeI CAATTG 1 cut(s) 582
MflI RGATCY 2 cut(s) 419, 664
MhlI GDGCHC 2 cut(s) 401, 472
MlsI TGGCCA 1 cut(s) 147
MluCI AATT 4 cut(s) 108, 577, 582, 756
MluNI TGGCCA 1 cut(s) 147
MlyI GAGTC 2 cut(s) 174, 512
MmeI TCCRAC 3 cut(s) 189, 574, 700
Mox20I TGGCCA 1 cut(s) 147
Mph1103I ATGCAT 1 cut(s) 637
MscI TGGCCA 1 cut(s) 147
MseI TTAA 2 cut(s) 15, 546
MslI CAYNNNNRTG 3 cut(s) 100, 141, 947
Msp20I TGGCCA 1 cut(s) 147
MunI CAATTG 1 cut(s) 582
Mva1269I GAATGC 1 cut(s) 120
MwoI GCNNNNNNNGC 2 cut(s) 225, 512
NcoI CCATGG 2 cut(s) 90, 142
NdeI CATATG 1 cut(s) 442
NdeII GATC 3 cut(s) 419, 664, 837
NlaIV GGNNCC 3 cut(s) 407, 421, 697
NmuCI GTSAC 1 cut(s) 848
NsbI TGCGCA 1 cut(s) 227
NsiI ATGCAT 1 cut(s) 637
NspI RCATGY 4 cut(s) 496, 677, 730, 946
PagI TCATGA 1 cut(s) 472
PciI ACATGT 3 cut(s) 673, 726, 942
PcsI WCGNNNNNNNCGW 1 cut(s) 885
PctI GAATGC 1 cut(s) 120
PfeI GAWTC 4 cut(s) 64, 772, 958, 1017
PflMI CCANNNNNTGG 1 cut(s) 485
PkrI GCNGC 2 cut(s) 514, 1012
PleI GAGTC 2 cut(s) 174, 512
PpsI GAGTC 2 cut(s) 174, 512
PscI ACATGT 3 cut(s) 673, 726, 942
PshBI ATTAAT 1 cut(s) 15
PspFI CCCAGC 1 cut(s) 745
PspN4I GGNNCC 3 cut(s) 407, 421, 697
PspPI GGNCC 1 cut(s) 696
PstI CTGCAG 1 cut(s) 1015
PsuI RGATCY 2 cut(s) 419, 664
RseI CAYNNNNRTG 3 cut(s) 100, 141, 947
SaqAI TTAA 2 cut(s) 15, 546
SatI GCNGC 2 cut(s) 513, 1011
Sau3AI GATC 3 cut(s) 419, 664, 837
Sau96I GGNCC 1 cut(s) 696
SchI GAGTC 2 cut(s) 174, 512
SduI GDGCHC 2 cut(s) 401, 472
SfcI CTRYAG 1 cut(s) 1011
SinI GGWCC 1 cut(s) 696
SmiMI CAYNNNNRTG 3 cut(s) 100, 141, 947
SmlI CTYRAG 2 cut(s) 48, 764
SmoI CTYRAG 2 cut(s) 48, 764
Sse9I AATT 4 cut(s) 108, 577, 582, 756
SspMI CTAG 1 cut(s) 177
StyI CCWWGG 3 cut(s) 90, 142, 479
TaaI ACNGT 4 cut(s) 345, 658, 889, 933
TaiI ACGT 1 cut(s) 270
TaqI TCGA 4 cut(s) 363, 459, 533, 836
TasI AATT 4 cut(s) 108, 577, 582, 756
TfiI GAWTC 4 cut(s) 64, 772, 958, 1017
Tru1I TTAA 2 cut(s) 15, 546
Tru9I TTAA 2 cut(s) 15, 546
TscAI CASTG 4 cut(s) 661, 970, 985, 1050
TseFI GTSAC 1 cut(s) 848
TseI GCWGC 2 cut(s) 512, 1010
Tsp45I GTSAC 1 cut(s) 848
TspDTI ATGAA 6 cut(s) 70, 199, 260, 489, 807, 920
TspGWI ACGGA 1 cut(s) 432
TspRI CASTG 4 cut(s) 661, 970, 985, 1050
Van91I CCANNNNNTGG 1 cut(s) 485
VpaK11BI GGWCC 1 cut(s) 696
VspI ATTAAT 1 cut(s) 15
XapI RAATTY 1 cut(s) 577
XbaI TCTAGA 1 cut(s) 176
XceI RCATGY 4 cut(s) 496, 677, 730, 946
XspI CTAG 1 cut(s) 177
Zsp2I ATGCAT 1 cut(s) 637
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.