pycom14g14440

Belongs to the glycosyl hydrolase 18 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
OG0000775
Physical Location & Seq
Forward (+)
17200855 .. 17201129
275 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g14440.2

Sequence Viewer

Length: 228 bp
ATGGCAACAGTTGTGTTTGATGCCGAATCAGCGTCTTACTATTCTTATTCGGGTAGATCTTGGATCGGGTATGATGGTGTCCAATCCGTGGACGTGAAGGTCCGGTTTGCGAAGTTGTTGGGCTTGGGCGGATACTTCTTTTGGGCTCTGGGCCAGGACAATGAATGGGCCATATCAAACAAGGTGAGGTTCCAACCCAAACTCAATTTGAATTCAATATTGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00520 ko01100 map00520 map01100
Pfam Domains
Protein Families
Glyco_hydro_18

Protein Analysis

76

Amino Acids

8.49

Weight (kDa)

8.01

Isoelectric Point (pI)

29.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 98
AccB7I CCANNNNNTGG 1 cut(s) 88
AciI CCGC 1 cut(s) 129
AclWI GGATC 1 cut(s) 71
AcsI RAATTY 1 cut(s) 211
AfiI CCNNNNNNNGG 1 cut(s) 88
AgsI TTSAA 2 cut(s) 211, 216
AjiI CACGTC 1 cut(s) 94
AjnI CCWGG 1 cut(s) 153
AlwI GGATC 1 cut(s) 71
AoxI GGCC 2 cut(s) 151, 168
ApoI RAATTY 1 cut(s) 211
AspS9I GGNCC 3 cut(s) 100, 151, 168
AsuHPI GGTGA 1 cut(s) 196
AvaII GGWCC 1 cut(s) 100
BanII GRGCYC 1 cut(s) 148
BccI CCATC 1 cut(s) 68
BciT130I CCWGG 1 cut(s) 155
BciVI GTATCC 1 cut(s) 125
BfuI GTATCC 1 cut(s) 125
BglII AGATCT 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 155
Bme18I GGWCC 1 cut(s) 100
BmgBI CACGTC 1 cut(s) 94
BmgT120I GGNCC 3 cut(s) 100, 151, 168
BmiI GGNNCC 1 cut(s) 191
BmrFI CCNGG 1 cut(s) 155
BmsI GCATC 1 cut(s) 10
BsaJI CCNNGG 1 cut(s) 87
BsaWI WCCGGW 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 88
BseBI CCWGG 1 cut(s) 155
BseDI CCNNGG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 88
BshFI GGCC 2 cut(s) 153, 170
BsiSI CCGG 1 cut(s) 103
BslI CCNNNNNNNGG 1 cut(s) 88
BsnI GGCC 2 cut(s) 153, 170
Bsp1286I GDGCHC 1 cut(s) 148
Bsp143I GATC 2 cut(s) 56, 63
BspACI CCGC 1 cut(s) 129
BspANI GGCC 2 cut(s) 153, 170
BspLI GGNNCC 1 cut(s) 191
BspPI GGATC 1 cut(s) 71
BssECI CCNNGG 1 cut(s) 87
BssMI GATC 2 cut(s) 56, 63
Bst2UI CCWGG 1 cut(s) 155
Bst4CI ACNGT 1 cut(s) 10
BstDSI CCRYGG 1 cut(s) 87
BstKTI GATC 2 cut(s) 59, 66
BstMBI GATC 2 cut(s) 56, 63
BstMWI GCNNNNNNNGC 1 cut(s) 29
BstNI CCWGG 1 cut(s) 155
BstSCI CCNGG 1 cut(s) 153
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BsuI GTATCC 1 cut(s) 125
BsuRI GGCC 2 cut(s) 153, 170
BtgI CCRYGG 1 cut(s) 87
BtrI CACGTC 1 cut(s) 94
Cfr13I GGNCC 3 cut(s) 100, 151, 168
CseI GACGC 1 cut(s) 21
CviJI RGCY 4 cut(s) 123, 146, 153, 170
CviKI_1 RGCY 4 cut(s) 123, 146, 153, 170
DpnI GATC 2 cut(s) 58, 65
DpnII GATC 2 cut(s) 56, 63
DrdI GACNNNNNNGTC 1 cut(s) 98
DseDI GACNNNNNNGTC 1 cut(s) 98
EciI GGCGGA 1 cut(s) 144
Eco24I GRGCYC 1 cut(s) 148
Eco47I GGWCC 1 cut(s) 100
EcoRI GAATTC 1 cut(s) 211
EcoRII CCWGG 1 cut(s) 153
EcoT38I GRGCYC 1 cut(s) 148
FaiI YATR 2 cut(s) 72, 173
FriOI GRGCYC 1 cut(s) 148
HaeIII GGCC 2 cut(s) 153, 170
HapII CCGG 1 cut(s) 103
HgaI GACGC 1 cut(s) 21
HinfI GANTC 1 cut(s) 26
HpaII CCGG 1 cut(s) 103
HphI GGTGA 1 cut(s) 196
Hpy166II GTNNAC 1 cut(s) 91
Hpy8I GTNNAC 1 cut(s) 91
HpyAV CCTTC 1 cut(s) 91
HpyCH4III ACNGT 1 cut(s) 10
HpyCH4IV ACGT 1 cut(s) 93
HpyF10VI GCNNNNNNNGC 1 cut(s) 29
HpySE526I ACGT 1 cut(s) 93
Kzo9I GATC 2 cut(s) 56, 63
LpnPI CCDG 4 cut(s) 116, 134, 140, 167
LweI GCATC 1 cut(s) 10
MaeII ACGT 1 cut(s) 93
MalI GATC 2 cut(s) 58, 65
MboI GATC 2 cut(s) 56, 63
MflI RGATCY 1 cut(s) 56
MhlI GDGCHC 1 cut(s) 148
MluCI AATT 2 cut(s) 205, 211
MmeI TCCRAC 1 cut(s) 217
MnlI CCTC 1 cut(s) 180
MseI TTAA 1 cut(s) 226
MspI CCGG 1 cut(s) 103
MspR9I CCNGG 1 cut(s) 155
MvaI CCWGG 1 cut(s) 155
MwoI GCNNNNNNNGC 1 cut(s) 29
NdeII GATC 2 cut(s) 56, 63
NlaIV GGNNCC 1 cut(s) 191
PfeI GAWTC 1 cut(s) 26
PflMI CCANNNNNTGG 1 cut(s) 88
Psp6I CCWGG 1 cut(s) 153
PspGI CCWGG 1 cut(s) 153
PspN4I GGNNCC 1 cut(s) 191
PspPI GGNCC 3 cut(s) 100, 151, 168
PsuI RGATCY 1 cut(s) 56
SaqAI TTAA 1 cut(s) 226
Sau3AI GATC 2 cut(s) 56, 63
Sau96I GGNCC 3 cut(s) 100, 151, 168
ScrFI CCNGG 1 cut(s) 155
SduI GDGCHC 1 cut(s) 148
SetI ASST 4 cut(s) 96, 102, 186, 191
SfaNI GCATC 1 cut(s) 10
SinI GGWCC 1 cut(s) 100
Sse9I AATT 2 cut(s) 205, 211
SsiI CCGC 1 cut(s) 129
SspI AATATT 1 cut(s) 219
StyD4I CCNGG 1 cut(s) 153
TaaI ACNGT 1 cut(s) 10
TaiI ACGT 1 cut(s) 96
TasI AATT 2 cut(s) 205, 211
TfiI GAWTC 1 cut(s) 26
Tru1I TTAA 1 cut(s) 226
Tru9I TTAA 1 cut(s) 226
TspDTI ATGAA 1 cut(s) 177
TspGWI ACGGA 1 cut(s) 76
Van91I CCANNNNNTGG 1 cut(s) 88
VpaK11BI GGWCC 1 cut(s) 100
XapI RAATTY 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.