RchiOBHm_Chr2g0086261

Glyco_18

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
1390156 .. 1390347
192 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGCTGGTCAGTAAATATTGCTACAATGGAAGGACTTGGATTGGTTACGATGATACGCATAGTATTAGGTCCAAGGTTTCGTATGCTAATGGAAAGTCTCTTCTTGCTTACTTTGCTTGGCATATTGGTGCTGACACAAGTCACACAACTACTCGGACTCTTTCTCAAACAAATAATTACCCTATAAATTAG

Protein Analysis

63

Amino Acids

7.19

Weight (kDa)

9.25

Isoelectric Point (pI)

17.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Glyco_hydro_18 PF00704 4 - 45 1.7e-07 Glycosyl hydrolases family 18
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Alw26I GTCTC 1 cut(s) 102
AspS9I GGNCC 1 cut(s) 69
AvaII GGWCC 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 102
Bme18I GGWCC 1 cut(s) 69
BmgT120I GGNCC 1 cut(s) 69
BoxI GACNNNNGTC 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 72
BseDI CCNNGG 1 cut(s) 72
BsmAI GTCTC 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 72
BssT1I CCWWGG 1 cut(s) 72
Bst6I CTCTTC 1 cut(s) 105
BstMAI GTCTC 1 cut(s) 102
BstMWI GCNNNNNNNGC 1 cut(s) 113
BstPAI GACNNNNGTC 1 cut(s) 138
Cfr13I GGNCC 1 cut(s) 69
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
Eco130I CCWWGG 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 72
ErhI CCWWGG 1 cut(s) 72
FaiI YATR 4 cut(s) 60, 84, 123, 185
HinfI GANTC 1 cut(s) 157
Hpy188I TCNGA 1 cut(s) 156
HpyAV CCTTC 1 cut(s) 24
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
MaeIII GTNAC 2 cut(s) 44, 140
MboII GAAGA 1 cut(s) 92
MluCI AATT 2 cut(s) 175, 187
MlyI GAGTC 1 cut(s) 151
MslI CAYNNNNRTG 1 cut(s) 126
MwoI GCNNNNNNNGC 1 cut(s) 113
NmuCI GTSAC 1 cut(s) 140
PleI GAGTC 1 cut(s) 151
PpsI GAGTC 1 cut(s) 151
PshAI GACNNNNGTC 1 cut(s) 138
PspPI GGNCC 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 126
Sau96I GGNCC 1 cut(s) 69
SchI GAGTC 1 cut(s) 151
SetI ASST 2 cut(s) 71, 78
SgeI CNNG 7 cut(s) 17, 48, 85, 116, 129, 150, 165
SinI GGWCC 1 cut(s) 69
SmiMI CAYNNNNRTG 1 cut(s) 126
Sse9I AATT 2 cut(s) 175, 187
SspI AATATT 1 cut(s) 17
StyI CCWWGG 1 cut(s) 72
TasI AATT 2 cut(s) 175, 187
TseFI GTSAC 1 cut(s) 140
Tsp45I GTSAC 1 cut(s) 140
VpaK11BI GGWCC 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.