RchiOBHm_Chr1g0324551

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
12288649 .. 12288834
186 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGTCGAAGCGTAAGTTAAATCGACTATTGACTGAAAATTGGGTTGATGGTTGGGATGATCCACACCTTATGACACTAGCTGGTTTACGACGTAGGGGCGTGACATCAACTGCCATTAATACATTTGTTAGAGGAATTGGAATCACCAGAAGTGATTGTGGTATGATTCATCTGAGTTGCCTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

61

Amino Acids

6.88

Weight (kDa)

10.07

Isoelectric Point (pI)

53.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_1c PF00749 1 - 52 3e-11 tRNA synthetases class I (E and Q), catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 53
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
AlwI GGATC 1 cut(s) 53
AseI ATTAAT 1 cut(s) 117
AsuHPI GGTGA 1 cut(s) 136
BccI CCATC 1 cut(s) 41
BfaI CTAG 2 cut(s) 77, 184
BseGI GGATG 1 cut(s) 61
BseMII CTCAG 1 cut(s) 164
Bsp143I GATC 1 cut(s) 58
BspCNI CTCAG 1 cut(s) 165
BspPI GGATC 1 cut(s) 53
BssMI GATC 1 cut(s) 58
BstDEI CTNAG 1 cut(s) 173
BstF5I GGATG 1 cut(s) 61
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BtsCI GGATG 1 cut(s) 61
CviJI RGCY 1 cut(s) 80
CviKI_1 RGCY 1 cut(s) 80
DdeI CTNAG 1 cut(s) 173
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
FaiI YATR 2 cut(s) 71, 164
FokI GGATG 1 cut(s) 68
FspBI CTAG 2 cut(s) 77, 184
HinfI GANTC 2 cut(s) 141, 166
HphI GGTGA 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 174
Hpy8I GTNNAC 1 cut(s) 86
Hpy99I CGWCG 1 cut(s) 93
HpyCH4IV ACGT 1 cut(s) 91
HpyF3I CTNAG 1 cut(s) 173
HpySE526I ACGT 1 cut(s) 91
Kzo9I GATC 1 cut(s) 58
LpnPI CCDG 2 cut(s) 66, 160
MaeI CTAG 2 cut(s) 77, 184
MaeII ACGT 1 cut(s) 91
MaeIII GTNAC 1 cut(s) 100
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MluCI AATT 2 cut(s) 37, 135
MnlI CCTC 1 cut(s) 125
MseI TTAA 2 cut(s) 17, 117
NdeII GATC 1 cut(s) 58
NmuCI GTSAC 1 cut(s) 100
PfeI GAWTC 2 cut(s) 141, 166
PshBI ATTAAT 1 cut(s) 117
SaqAI TTAA 2 cut(s) 17, 117
Sau3AI GATC 1 cut(s) 58
SetI ASST 3 cut(s) 69, 82, 94
SgeI CNNG 4 cut(s) 89, 93, 112, 159
Sse9I AATT 2 cut(s) 37, 135
SspMI CTAG 2 cut(s) 77, 184
TaiI ACGT 1 cut(s) 94
TaqI TCGA 2 cut(s) 5, 22
TasI AATT 2 cut(s) 37, 135
TfiI GAWTC 2 cut(s) 141, 166
Tru1I TTAA 2 cut(s) 17, 117
Tru9I TTAA 2 cut(s) 17, 117
TseFI GTSAC 1 cut(s) 100
Tsp45I GTSAC 1 cut(s) 100
TspDTI ATGAA 1 cut(s) 158
VspI ATTAAT 1 cut(s) 117
XspI CTAG 2 cut(s) 77, 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.