Rh6CG152100

Belongs to the class-I aminoacyl-tRNA synthetase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0000872
Physical Location & Seq
Forward (+)
19813643 .. 19814449
807 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG152100.1

Sequence Viewer

Length: 327 bp
ATGACCATATTGCATATCGTATCAAGTTTACTCCTCATCCGCACGCTGGAGACAAGTGGTCCACAAGTTACAATTATGCTCATTGCATTGTGGATTCTCTTGAGAATATTTACCCATTCGCTGTGCACTTTAGAATTTGAGACACATCGTGGTTCATACTACTGGCTATTGCATTCTCTGGGCCTATATCAACCACATGTTTGGGAATATTCAAGACTGAATGTCAGTAACACTATTATGTCAAAGCGTAAGTTAAATCGACTAGTGACTGAAAATTGGGTTGATGGTTGGAATGATCCACGCCATATGACACTGGCTGGTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00970 ko01100 map00970 map01100
Pfam Domains
Protein Families
tRNA-synt_1c tRNA-synt_1c_C tRNA_synt_1c_R1 tRNA_synt_1c_R2

Protein Analysis

108

Amino Acids

12.68

Weight (kDa)

8.98

Isoelectric Point (pI)

36.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_1c PF00749 37 - 108 1.2e-21 tRNA synthetases class I (E and Q), catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 40
AclWI GGATC 1 cut(s) 290
AcsI RAATTY 1 cut(s) 134
AdeI CACNNNGTG 1 cut(s) 149
AfiI CCNNNNNNNGG 1 cut(s) 46
AflIII ACRYGT 1 cut(s) 196
AgsI TTSAA 1 cut(s) 213
AhdI GACNNNNNGTC 2 cut(s) 57, 221
AhlI ACTAGT 1 cut(s) 262
Alw21I GWGCWC 1 cut(s) 128
Alw26I GTCTC 2 cut(s) 44, 134
Alw44I GTGCAC 1 cut(s) 124
AlwI GGATC 1 cut(s) 290
AoxI GGCC 1 cut(s) 181
ApaLI GTGCAC 1 cut(s) 124
ApoI RAATTY 1 cut(s) 134
AspS9I GGNCC 2 cut(s) 59, 181
AvaII GGWCC 1 cut(s) 59
BaeGI GKGCMC 1 cut(s) 128
Bbv12I GWGCWC 1 cut(s) 128
BccI CCATC 1 cut(s) 278
BcoDI GTCTC 2 cut(s) 44, 134
BcuI ACTAGT 1 cut(s) 262
BfaI CTAG 1 cut(s) 263
Bme18I GGWCC 1 cut(s) 59
BmeRI GACNNNNNGTC 2 cut(s) 57, 221
BmgT120I GGNCC 2 cut(s) 59, 181
BpmI CTGGAG 1 cut(s) 68
BpuEI CTTGAG 1 cut(s) 121
Bsc4I CCNNNNNNNGG 1 cut(s) 46
Bse1I ACTGG 2 cut(s) 167, 318
Bse3DI GCAATG 1 cut(s) 81
BseGI GGATG 1 cut(s) 36
BseLI CCNNNNNNNGG 1 cut(s) 46
BseMI GCAATG 1 cut(s) 81
BseNI ACTGG 2 cut(s) 167, 318
BseRI GAGGAG 1 cut(s) 23
BseSI GKGCMC 1 cut(s) 128
BshFI GGCC 1 cut(s) 183
BsiHKAI GWGCWC 1 cut(s) 128
BslI CCNNNNNNNGG 1 cut(s) 46
BsmAI GTCTC 2 cut(s) 44, 134
BsmI GAATGC 1 cut(s) 172
BsnI GGCC 1 cut(s) 183
Bsp1286I GDGCHC 1 cut(s) 128
Bsp143I GATC 1 cut(s) 295
BspACI CCGC 1 cut(s) 40
BspANI GGCC 1 cut(s) 183
BspPI GGATC 1 cut(s) 290
BsrDI GCAATG 1 cut(s) 81
BsrI ACTGG 2 cut(s) 167, 318
BssMI GATC 1 cut(s) 295
BstC8I GCNNGC 1 cut(s) 44
BstF5I GGATG 1 cut(s) 36
BstKTI GATC 1 cut(s) 298
BstMAI GTCTC 2 cut(s) 44, 134
BstMBI GATC 1 cut(s) 295
BstNSI RCATGY 1 cut(s) 200
BstSLI GKGCMC 1 cut(s) 128
BstXI CCANNNNNNTGG 1 cut(s) 201
BsuRI GGCC 1 cut(s) 183
BtsCI GGATG 1 cut(s) 36
BtsIMutI CAGTG 1 cut(s) 311
Cac8I GCNNGC 1 cut(s) 44
Cfr13I GGNCC 2 cut(s) 59, 181
CviAII CATG 1 cut(s) 197
CviJI RGCY 3 cut(s) 166, 183, 317
CviKI_1 RGCY 3 cut(s) 166, 183, 317
DpnI GATC 1 cut(s) 297
DpnII GATC 1 cut(s) 295
DraIII CACNNNGTG 1 cut(s) 149
DriI GACNNNNNGTC 2 cut(s) 57, 221
Eam1105I GACNNNNNGTC 2 cut(s) 57, 221
Eco47I GGWCC 1 cut(s) 59
FaeI CATG 1 cut(s) 200
FatI CATG 1 cut(s) 196
FauNDI CATATG 1 cut(s) 306
FokI GGATG 1 cut(s) 23
FspBI CTAG 1 cut(s) 263
GsuI CTGGAG 1 cut(s) 68
HaeIII GGCC 1 cut(s) 183
Hin1II CATG 1 cut(s) 200
HinfI GANTC 1 cut(s) 94
Hpy166II GTNNAC 3 cut(s) 29, 62, 126
Hpy188III TCNNGA 2 cut(s) 100, 213
Hpy8I GTNNAC 3 cut(s) 29, 62, 126
HpyCH4V TGCA 4 cut(s) 13, 86, 126, 172
Hsp92II CATG 1 cut(s) 200
Kzo9I GATC 1 cut(s) 295
LpnPI CCDG 5 cut(s) 32, 148, 164, 299, 303
MaeI CTAG 1 cut(s) 263
MaeIII GTNAC 3 cut(s) 67, 227, 265
MalI GATC 1 cut(s) 297
MboI GATC 1 cut(s) 295
MhlI GDGCHC 1 cut(s) 128
MluCI AATT 3 cut(s) 72, 134, 274
MmeI TCCRAC 1 cut(s) 269
MnlI CCTC 1 cut(s) 44
MseI TTAA 1 cut(s) 254
MslI CAYNNNNRTG 1 cut(s) 236
Mva1269I GAATGC 1 cut(s) 172
NdeI CATATG 1 cut(s) 306
NdeII GATC 1 cut(s) 295
NlaIII CATG 1 cut(s) 200
NmuCI GTSAC 1 cut(s) 265
NspI RCATGY 1 cut(s) 200
PciI ACATGT 1 cut(s) 196
PctI GAATGC 1 cut(s) 172
PfeI GAWTC 1 cut(s) 94
PscI ACATGT 1 cut(s) 196
PspPI GGNCC 2 cut(s) 59, 181
RseI CAYNNNNRTG 1 cut(s) 236
SaqAI TTAA 1 cut(s) 254
Sau3AI GATC 1 cut(s) 295
Sau96I GGNCC 2 cut(s) 59, 181
SduI GDGCHC 1 cut(s) 128
SinI GGWCC 1 cut(s) 59
SmiMI CAYNNNNRTG 1 cut(s) 236
SmlI CTYRAG 1 cut(s) 100
SmoI CTYRAG 1 cut(s) 100
SpeI ACTAGT 1 cut(s) 262
Sse9I AATT 3 cut(s) 72, 134, 274
SsiI CCGC 1 cut(s) 40
SspI AATATT 2 cut(s) 108, 209
SspMI CTAG 1 cut(s) 263
TaqI TCGA 1 cut(s) 259
TasI AATT 3 cut(s) 72, 134, 274
TfiI GAWTC 1 cut(s) 94
Tru1I TTAA 1 cut(s) 254
Tru9I TTAA 1 cut(s) 254
TscAI CASTG 1 cut(s) 318
TseFI GTSAC 1 cut(s) 265
Tsp45I GTSAC 1 cut(s) 265
TspDTI ATGAA 1 cut(s) 144
TspRI CASTG 1 cut(s) 318
VneI GTGCAC 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 59
XapI RAATTY 1 cut(s) 134
XceI RCATGY 1 cut(s) 200
XspI CTAG 1 cut(s) 263
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.