RchiOBHm_Chr6g0267561

Belongs to the class-I aminoacyl-tRNA synthetase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0000872
Physical Location & Seq
Forward (+)
24417601 .. 24418575
975 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ23999

Sequence Viewer

Length: 333 bp
ATGAAACAAGATATGCAGAGTGATAATTTTAACATGTATGACCTTATTGCATATTGTATCAAGTTTACTCCTCATCCGCACGCTGGAGACACTTGGTCCACAAGTTACAATTATGCTCATTGCATTCTGTGCACTTTAGAATTTGAGACACATCGTGCTTCATACTTCTGGCTATTGCATTCTCTGGGCCTATATCAACCACATGTTTGGGAATATTCAAGACTGAATGTCAGTAACACTATTATGTCGAAGCGTAAGTTAAATCAACTAGTGACTGAAAATTGGGTTGATGGTTGGAATGATCCATGCCATATGACCCTGGCTGGTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00970 ko01100 map00970 map01100
Pfam Domains
Protein Families
tRNA-synt_1c tRNA-synt_1c_C tRNA_synt_1c_R1 tRNA_synt_1c_R2

Protein Analysis

110

Amino Acids

13.01

Weight (kDa)

6.11

Isoelectric Point (pI)

33.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA-synt_1c PF00749 1 - 110 9e-26 tRNA synthetases class I (E and Q), catalytic domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 77
AclWI GGATC 1 cut(s) 296
AcsI RAATTY 1 cut(s) 140
AdeI CACNNNGTG 1 cut(s) 155
AfiI CCNNNNNNNGG 1 cut(s) 83
AflIII ACRYGT 2 cut(s) 33, 202
AgsI TTSAA 1 cut(s) 219
AhdI GACNNNNNGTC 2 cut(s) 94, 227
AhlI ACTAGT 1 cut(s) 268
AjnI CCWGG 1 cut(s) 318
Alw21I GWGCWC 1 cut(s) 134
Alw26I GTCTC 2 cut(s) 81, 140
Alw44I GTGCAC 1 cut(s) 130
AlwI GGATC 1 cut(s) 296
AoxI GGCC 1 cut(s) 187
ApaLI GTGCAC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 140
AspS9I GGNCC 2 cut(s) 96, 187
AvaII GGWCC 1 cut(s) 96
BaeGI GKGCMC 1 cut(s) 134
Bbv12I GWGCWC 1 cut(s) 134
BccI CCATC 1 cut(s) 284
BciT130I CCWGG 1 cut(s) 320
BcoDI GTCTC 2 cut(s) 81, 140
BcuI ACTAGT 1 cut(s) 268
BfaI CTAG 1 cut(s) 269
Bme1390I CCNGG 1 cut(s) 320
Bme18I GGWCC 1 cut(s) 96
BmeRI GACNNNNNGTC 2 cut(s) 94, 227
BmgT120I GGNCC 2 cut(s) 96, 187
BmrFI CCNGG 1 cut(s) 320
BpmI CTGGAG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 318
Bsc4I CCNNNNNNNGG 1 cut(s) 83
Bse3DI GCAATG 1 cut(s) 118
BseBI CCWGG 1 cut(s) 320
BseDI CCNNGG 1 cut(s) 318
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 83
BseMI GCAATG 1 cut(s) 118
BseRI GAGGAG 1 cut(s) 60
BseSI GKGCMC 1 cut(s) 134
BshFI GGCC 1 cut(s) 189
BsiHKAI GWGCWC 1 cut(s) 134
BslI CCNNNNNNNGG 1 cut(s) 83
BsmAI GTCTC 2 cut(s) 81, 140
BsmI GAATGC 2 cut(s) 123, 178
BsnI GGCC 1 cut(s) 189
Bsp1286I GDGCHC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 301
BspACI CCGC 1 cut(s) 77
BspANI GGCC 1 cut(s) 189
BspPI GGATC 1 cut(s) 296
BsrDI GCAATG 1 cut(s) 118
BssECI CCNNGG 1 cut(s) 318
BssMI GATC 1 cut(s) 301
Bst2UI CCWGG 1 cut(s) 320
BstAPI GCANNNNNTGC 1 cut(s) 129
BstC8I GCNNGC 1 cut(s) 81
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 1 cut(s) 304
BstMAI GTCTC 2 cut(s) 81, 140
BstMBI GATC 1 cut(s) 301
BstMWI GCNNNNNNNGC 1 cut(s) 129
BstNI CCWGG 1 cut(s) 320
BstNSI RCATGY 2 cut(s) 37, 206
BstSCI CCNGG 1 cut(s) 318
BstSLI GKGCMC 1 cut(s) 134
BstXI CCANNNNNNTGG 1 cut(s) 207
BsuRI GGCC 1 cut(s) 189
BtsCI GGATG 1 cut(s) 73
Cac8I GCNNGC 1 cut(s) 81
Cfr13I GGNCC 2 cut(s) 96, 187
CviAII CATG 3 cut(s) 34, 203, 306
CviJI RGCY 3 cut(s) 172, 189, 323
CviKI_1 RGCY 3 cut(s) 172, 189, 323
DpnI GATC 1 cut(s) 303
DpnII GATC 1 cut(s) 301
DraIII CACNNNGTG 1 cut(s) 155
DriI GACNNNNNGTC 2 cut(s) 94, 227
Eam1105I GACNNNNNGTC 2 cut(s) 94, 227
Eco47I GGWCC 1 cut(s) 96
EcoRII CCWGG 1 cut(s) 318
FaeI CATG 3 cut(s) 37, 206, 309
FatI CATG 3 cut(s) 33, 202, 305
FauNDI CATATG 1 cut(s) 312
FokI GGATG 1 cut(s) 60
FspBI CTAG 1 cut(s) 269
GsuI CTGGAG 1 cut(s) 105
HaeIII GGCC 1 cut(s) 189
Hin1II CATG 3 cut(s) 37, 206, 309
Hpy166II GTNNAC 3 cut(s) 66, 99, 132
Hpy188III TCNNGA 1 cut(s) 219
Hpy8I GTNNAC 3 cut(s) 66, 99, 132
HpyCH4V TGCA 5 cut(s) 16, 50, 123, 132, 178
HpyF10VI GCNNNNNNNGC 1 cut(s) 129
Hsp92II CATG 3 cut(s) 37, 206, 309
Kzo9I GATC 1 cut(s) 301
LpnPI CCDG 5 cut(s) 69, 154, 170, 305, 309
MaeI CTAG 1 cut(s) 269
MaeIII GTNAC 3 cut(s) 104, 233, 271
MalI GATC 1 cut(s) 303
MboI GATC 1 cut(s) 301
MhlI GDGCHC 1 cut(s) 134
MluCI AATT 4 cut(s) 25, 109, 140, 280
MmeI TCCRAC 1 cut(s) 275
MnlI CCTC 1 cut(s) 81
MseI TTAA 2 cut(s) 30, 260
MslI CAYNNNNRTG 1 cut(s) 242
MspR9I CCNGG 1 cut(s) 320
Mva1269I GAATGC 2 cut(s) 123, 178
MvaI CCWGG 1 cut(s) 320
MwoI GCNNNNNNNGC 1 cut(s) 129
NdeI CATATG 1 cut(s) 312
NdeII GATC 1 cut(s) 301
NlaIII CATG 3 cut(s) 37, 206, 309
NmuCI GTSAC 1 cut(s) 271
NspI RCATGY 2 cut(s) 37, 206
PciI ACATGT 2 cut(s) 33, 202
PctI GAATGC 2 cut(s) 123, 178
PscI ACATGT 2 cut(s) 33, 202
Psp6I CCWGG 1 cut(s) 318
PspGI CCWGG 1 cut(s) 318
PspPI GGNCC 2 cut(s) 96, 187
RseI CAYNNNNRTG 1 cut(s) 242
SaqAI TTAA 2 cut(s) 30, 260
Sau3AI GATC 1 cut(s) 301
Sau96I GGNCC 2 cut(s) 96, 187
ScrFI CCNGG 1 cut(s) 320
SduI GDGCHC 1 cut(s) 134
SetI ASST 1 cut(s) 45
SinI GGWCC 1 cut(s) 96
SmiMI CAYNNNNRTG 1 cut(s) 242
SpeI ACTAGT 1 cut(s) 268
Sse9I AATT 4 cut(s) 25, 109, 140, 280
SsiI CCGC 1 cut(s) 77
SspI AATATT 1 cut(s) 215
SspMI CTAG 1 cut(s) 269
StyD4I CCNGG 1 cut(s) 318
TaqI TCGA 1 cut(s) 248
TasI AATT 4 cut(s) 25, 109, 140, 280
Tru1I TTAA 2 cut(s) 30, 260
Tru9I TTAA 2 cut(s) 30, 260
TseFI GTSAC 1 cut(s) 271
Tsp45I GTSAC 1 cut(s) 271
TspDTI ATGAA 2 cut(s) 17, 150
VneI GTGCAC 1 cut(s) 130
VpaK11BI GGWCC 1 cut(s) 96
XapI RAATTY 1 cut(s) 140
XceI RCATGY 2 cut(s) 37, 206
XspI CTAG 1 cut(s) 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.