RchiOBHm_Chr1g0339091

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
30373912 .. 30377408
3497 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56604

Sequence Viewer

Length: 330 bp
ATGAGGTTGAACCACACCCTTCTTTACCACCCCCAGAATCCAGTAATGGCAGCAAAAACTGGAAAGACAAAGATGATGAGACTTCTACGAGATGATAATGCAGAGGATCAAGATACTCAAAGACAGGCAGAGAGAATTGATATGGACACACATTCTCAGATTATATCAAGAAAGTGGAAACAAGGTTGTCAAAGAAGATCAAGAAGGTTGAAAGAAGCATCTCAGCTTTTGTTGATCGAACAGAATCTGCCTTTTTTTGCTTGGTTGATTGGGTATTGCTGTGTCAAGCGTGAAGGTAATCAGTCATACCAAGGACCACTAGAGGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.87

Weight (kDa)

9.55

Isoelectric Point (pI)

54.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 114
AgsI TTSAA 2 cut(s) 10, 211
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
Alw26I GTCTC 1 cut(s) 73
AlwI GGATC 1 cut(s) 114
AlwNI CAGNNNCTG 1 cut(s) 247
ApeKI GCWGC 1 cut(s) 50
AspS9I GGNCC 1 cut(s) 314
AvaII GGWCC 1 cut(s) 314
BbvI GCAGC 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 73
BfaI CTAG 1 cut(s) 320
BisI GCNGC 1 cut(s) 51
BlsI GCNGC 1 cut(s) 52
Bme18I GGWCC 1 cut(s) 314
BmgT120I GGNCC 1 cut(s) 314
BmsI GCATC 1 cut(s) 227
BsaJI CCNNGG 1 cut(s) 310
Bse1I ACTGG 2 cut(s) 41, 64
BseDI CCNNGG 1 cut(s) 310
BseMII CTCAG 2 cut(s) 170, 236
BseNI ACTGG 2 cut(s) 41, 64
BseXI GCAGC 1 cut(s) 62
BsmAI GTCTC 1 cut(s) 73
Bsp143I GATC 3 cut(s) 106, 197, 234
BspCNI CTCAG 2 cut(s) 169, 235
BspPI GGATC 1 cut(s) 114
BsrI ACTGG 2 cut(s) 41, 64
BssECI CCNNGG 1 cut(s) 310
BssMI GATC 3 cut(s) 106, 197, 234
BssT1I CCWWGG 1 cut(s) 310
BstDEI CTNAG 2 cut(s) 156, 222
BstKTI GATC 3 cut(s) 109, 200, 237
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 3 cut(s) 106, 197, 234
BstV1I GCAGC 1 cut(s) 62
CaiI CAGNNNCTG 1 cut(s) 247
Cfr13I GGNCC 1 cut(s) 314
CviJI RGCY 1 cut(s) 226
CviKI_1 RGCY 1 cut(s) 226
DdeI CTNAG 2 cut(s) 156, 222
DpnI GATC 3 cut(s) 108, 199, 236
DpnII GATC 3 cut(s) 106, 197, 234
Eco130I CCWWGG 1 cut(s) 310
Eco47I GGWCC 1 cut(s) 314
EcoT14I CCWWGG 1 cut(s) 310
ErhI CCWWGG 1 cut(s) 310
FaiI YATR 4 cut(s) 143, 164, 307, 328
Fnu4HI GCNGC 1 cut(s) 51
Fsp4HI GCNGC 1 cut(s) 51
FspBI CTAG 1 cut(s) 320
GluI GCNGC 1 cut(s) 51
HinfI GANTC 2 cut(s) 37, 244
Hpy188I TCNGA 1 cut(s) 159
Hpy188III TCNNGA 3 cut(s) 110, 168, 201
HpyAV CCTTC 3 cut(s) 29, 198, 287
HpyCH4V TGCA 1 cut(s) 101
HpyF3I CTNAG 2 cut(s) 156, 222
Kzo9I GATC 3 cut(s) 106, 197, 234
LpnPI CCDG 4 cut(s) 45, 47, 54, 110
Lsp1109I GCAGC 1 cut(s) 62
LweI GCATC 1 cut(s) 227
MaeI CTAG 1 cut(s) 320
MalI GATC 3 cut(s) 108, 199, 236
MboI GATC 3 cut(s) 106, 197, 234
MboII GAAGA 1 cut(s) 207
MluCI AATT 1 cut(s) 135
MnlI CCTC 2 cut(s) 97, 316
NdeII GATC 3 cut(s) 106, 197, 234
PfeI GAWTC 2 cut(s) 37, 244
PkrI GCNGC 1 cut(s) 52
PspPI GGNCC 1 cut(s) 314
PstNI CAGNNNCTG 1 cut(s) 247
SatI GCNGC 1 cut(s) 51
Sau3AI GATC 3 cut(s) 106, 197, 234
Sau96I GGNCC 1 cut(s) 314
SetI ASST 6 cut(s) 8, 187, 209, 228, 298, 327
SfaNI GCATC 1 cut(s) 227
SinI GGWCC 1 cut(s) 314
Sse9I AATT 1 cut(s) 135
SspMI CTAG 1 cut(s) 320
StyI CCWWGG 1 cut(s) 310
TaqI TCGA 1 cut(s) 237
TasI AATT 1 cut(s) 135
TfiI GAWTC 2 cut(s) 37, 244
TseI GCWGC 1 cut(s) 50
VpaK11BI GGWCC 1 cut(s) 314
XspI CTAG 1 cut(s) 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.