RchiOBHm_Chr5g0021421

Allantoate

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
15625266 .. 15627089
1824 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30148

Sequence Viewer

Length: 138 bp
ATGGATGGAAGATGCTGGTGGGTTGATTGCTTGGGAAATGTACATGGTCGAGTTGAGGGTAGGAATGCTAGTGCTGAGGCTCTACTACTTGGTTCTCATTTGGATACTGTTGTTGAGGCCAGGATATTTGATGGGTAA

Protein Analysis

45

Amino Acids

4.93

Weight (kDa)

4.96

Isoelectric Point (pI)

12.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 42
AjnI CCWGG 1 cut(s) 119
AoxI GGCC 1 cut(s) 117
BaeI ACNNNNGTAYC 2 cut(s) 96, 129
BbvCI CCTCAGC 1 cut(s) 75
BccI CCATC 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 121
BciVI GTATCC 1 cut(s) 97
BfaI CTAG 1 cut(s) 69
BfuI GTATCC 1 cut(s) 97
Bme1390I CCNGG 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 121
BmsI GCATC 1 cut(s) 2
Bpu10I CCTNAGC 1 cut(s) 75
BseBI CCWGG 1 cut(s) 121
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 1 cut(s) 66
BshFI GGCC 1 cut(s) 119
BsmI GAATGC 1 cut(s) 70
BsnI GGCC 1 cut(s) 119
Bsp1407I TGTACA 1 cut(s) 40
BspANI GGCC 1 cut(s) 119
BspCNI CTCAG 1 cut(s) 67
BsrGI TGTACA 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 121
Bst4CI ACNGT 1 cut(s) 109
BstAUI TGTACA 1 cut(s) 40
BstDEI CTNAG 1 cut(s) 75
BstF5I GGATG 1 cut(s) 10
BstNI CCWGG 1 cut(s) 121
BstSCI CCNGG 1 cut(s) 119
BsuI GTATCC 1 cut(s) 97
BsuRI GGCC 1 cut(s) 119
BtsCI GGATG 1 cut(s) 10
Csp6I GTAC 1 cut(s) 41
CviAII CATG 1 cut(s) 44
CviJI RGCY 2 cut(s) 80, 119
CviKI_1 RGCY 2 cut(s) 80, 119
CviQI GTAC 1 cut(s) 41
DdeI CTNAG 1 cut(s) 75
EcoRII CCWGG 1 cut(s) 119
FaeI CATG 1 cut(s) 47
FaiI YATR 1 cut(s) 45
FatI CATG 1 cut(s) 43
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 119
Hin1II CATG 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 109
HpyF3I CTNAG 1 cut(s) 75
Hsp92II CATG 1 cut(s) 47
LpnPI CCDG 2 cut(s) 106, 133
LweI GCATC 1 cut(s) 2
MaeI CTAG 1 cut(s) 69
MboII GAAGA 1 cut(s) 21
MnlI CCTC 3 cut(s) 49, 70, 109
MspR9I CCNGG 1 cut(s) 121
Mva1269I GAATGC 1 cut(s) 70
MvaI CCWGG 1 cut(s) 121
NlaIII CATG 1 cut(s) 47
PctI GAATGC 1 cut(s) 70
Psp6I CCWGG 1 cut(s) 119
PspGI CCWGG 1 cut(s) 119
RsaI GTAC 1 cut(s) 42
RsaNI GTAC 1 cut(s) 41
ScrFI CCNGG 1 cut(s) 121
SfaNI GCATC 1 cut(s) 2
SgeI CNNG 8 cut(s) 28, 43, 56, 62, 81, 101, 132, 133
SspMI CTAG 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 119
TaaI ACNGT 1 cut(s) 109
TaqI TCGA 1 cut(s) 49
TatI WGTACW 1 cut(s) 40
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.