Rmu_co8071990.1_g000001

Allantoate

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8071990.1
Physical Location & Seq
Forward (+)
1 .. 548
548 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8071990.1_g000001.1.cds

Sequence Viewer

Length: 222 bp
gtaagtgatggtgatggctatcttgagaggatattcatgagcccgggggctgtgagggcaggaaatctaatccgcgaatggatggagaatgcgggtttgcgaacgtgggttgattgcttgggaaatatacatggtcgagttgagggaaggaatgctagtgctgaagctctgttaattggttcccatttggtgatgttcttttcctccaaattccgttattga

Protein Analysis

73

Amino Acids

8.15

Weight (kDa)

6.9

Isoelectric Point (pI)

28.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 75
AciI CCGC 2 cut(s) 73, 92
AcsI RAATTY 1 cut(s) 209
AcuI CTGAAG 1 cut(s) 183
AluBI AGCT 1 cut(s) 167
AluI AGCT 1 cut(s) 167
Ama87I CYCGRG 1 cut(s) 43
ApoI RAATTY 1 cut(s) 209
AsuC2I CCSGG 2 cut(s) 44, 45
AsuHPI GGTGA 2 cut(s) 23, 202
AvaI CYCGRG 1 cut(s) 43
BanII GRGCYC 1 cut(s) 44
BccI CCATC 3 cut(s) 2, 8, 76
BcnI CCSGG 2 cut(s) 44, 45
BfaI CTAG 1 cut(s) 156
Bme1390I CCNGG 2 cut(s) 44, 45
BmeT110I CYCGRG 1 cut(s) 43
BmiI GGNNCC 1 cut(s) 181
BmrFI CCNGG 2 cut(s) 44, 45
BpuEI CTTGAG 1 cut(s) 44
BpuMI CCSGG 2 cut(s) 44, 45
BsaBI GATNNNNATC 1 cut(s) 18
BsaJI CCNNGG 2 cut(s) 43, 44
Bse8I GATNNNNATC 1 cut(s) 18
BseDI CCNNGG 2 cut(s) 43, 44
BseGI GGATG 1 cut(s) 87
BseJI GATNNNNATC 1 cut(s) 18
Bsh1236I CGCG 1 cut(s) 75
BsiHKCI CYCGRG 1 cut(s) 43
BsiSI CCGG 1 cut(s) 44
BsmI GAATGC 2 cut(s) 94, 157
BsoBI CYCGRG 1 cut(s) 43
Bsp1286I GDGCHC 1 cut(s) 44
BspACI CCGC 2 cut(s) 73, 92
BspFNI CGCG 1 cut(s) 75
BspHI TCATGA 1 cut(s) 36
BspLI GGNNCC 1 cut(s) 181
BssECI CCNNGG 2 cut(s) 43, 44
BstF5I GGATG 1 cut(s) 87
BstFNI CGCG 1 cut(s) 75
BstMWI GCNNNNNNNGC 1 cut(s) 56
BstSCI CCNGG 2 cut(s) 42, 43
BstUI CGCG 1 cut(s) 75
BtsCI GGATG 1 cut(s) 87
CciI TCATGA 1 cut(s) 36
Cfr9I CCCGGG 1 cut(s) 43
CviAII CATG 2 cut(s) 37, 131
CviJI RGCY 4 cut(s) 18, 42, 50, 167
CviKI_1 RGCY 4 cut(s) 18, 42, 50, 167
Eco24I GRGCYC 1 cut(s) 44
Eco57I CTGAAG 1 cut(s) 183
Eco88I CYCGRG 1 cut(s) 43
EcoT38I GRGCYC 1 cut(s) 44
FaeI CATG 2 cut(s) 40, 134
FaiI YATR 3 cut(s) 38, 128, 132
FatI CATG 2 cut(s) 36, 130
FauI CCCGC 1 cut(s) 85
FokI GGATG 1 cut(s) 94
FriOI GRGCYC 1 cut(s) 44
FspBI CTAG 1 cut(s) 156
HapII CCGG 1 cut(s) 44
Hin1II CATG 2 cut(s) 40, 134
HpaII CCGG 1 cut(s) 44
HphI GGTGA 2 cut(s) 23, 202
Hpy188III TCNNGA 2 cut(s) 23, 37
HpyAV CCTTC 1 cut(s) 141
HpyCH4IV ACGT 1 cut(s) 104
HpyF10VI GCNNNNNNNGC 1 cut(s) 56
HpySE526I ACGT 1 cut(s) 104
Hsp92II CATG 2 cut(s) 40, 134
LpnPI CCDG 2 cut(s) 45, 57
MaeI CTAG 1 cut(s) 156
MaeII ACGT 1 cut(s) 104
MhlI GDGCHC 1 cut(s) 44
MluCI AATT 2 cut(s) 174, 209
MnlI CCTC 4 cut(s) 21, 48, 136, 214
MseI TTAA 1 cut(s) 173
MspI CCGG 1 cut(s) 44
MspR9I CCNGG 2 cut(s) 44, 45
Mva1269I GAATGC 2 cut(s) 94, 157
MvnI CGCG 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 56
NciI CCSGG 2 cut(s) 44, 45
NlaIII CATG 2 cut(s) 40, 134
NlaIV GGNNCC 1 cut(s) 181
PagI TCATGA 1 cut(s) 36
PctI GAATGC 2 cut(s) 94, 157
PspN4I GGNNCC 1 cut(s) 181
SaqAI TTAA 1 cut(s) 173
ScrFI CCNGG 2 cut(s) 44, 45
SduI GDGCHC 1 cut(s) 44
SetI ASST 2 cut(s) 107, 169
SmaI CCCGGG 1 cut(s) 45
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
Sse9I AATT 2 cut(s) 174, 209
SsiI CCGC 2 cut(s) 73, 92
SspMI CTAG 1 cut(s) 156
StyD4I CCNGG 2 cut(s) 42, 43
TaiI ACGT 1 cut(s) 107
TaqI TCGA 1 cut(s) 136
TasI AATT 2 cut(s) 174, 209
Tru1I TTAA 1 cut(s) 173
Tru9I TTAA 1 cut(s) 173
TspDTI ATGAA 1 cut(s) 25
TspGWI ACGGA 1 cut(s) 203
TspMI CCCGGG 1 cut(s) 43
XapI RAATTY 1 cut(s) 209
XmaI CCCGGG 1 cut(s) 43
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.