RchiOBHm_Chr6g0272311

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
OG0000937
Physical Location & Seq
Forward (+)
32501693 .. 32508444
6752 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24429

Sequence Viewer

Length: 243 bp
ATGAGGTTGAACCACACCCTTCTTTACCACCCCCAGAATCCAGTAATGGCAGCAAAAACTAGAAAGACAAAGATGATGAGACTTCTACGAGATGATAATGCAGAGGATCAAGATACTCAAAGACAGGCAGAGAGAATTGATATGGACACACATTCTCATATTATATCAAGAAAACGGAAACAAGGTTGTCAAAGGAGATCAAGAAGGTTGAAAGAAGCATCTCAGCTTTTGTTGATCGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.61

Weight (kDa)

10.59

Isoelectric Point (pI)

65.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 114
AgsI TTSAA 2 cut(s) 10, 211
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
Alw26I GTCTC 1 cut(s) 73
AlwI GGATC 1 cut(s) 114
ApeKI GCWGC 1 cut(s) 50
BbvI GCAGC 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 73
BfaI CTAG 1 cut(s) 60
BisI GCNGC 1 cut(s) 51
BlsI GCNGC 1 cut(s) 52
BmsI GCATC 1 cut(s) 227
Bse1I ACTGG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 236
BseNI ACTGG 1 cut(s) 41
BseXI GCAGC 1 cut(s) 62
BsmAI GTCTC 1 cut(s) 73
Bsp143I GATC 3 cut(s) 106, 197, 234
BspCNI CTCAG 1 cut(s) 235
BspPI GGATC 1 cut(s) 114
BsrI ACTGG 1 cut(s) 41
BssMI GATC 3 cut(s) 106, 197, 234
BstDEI CTNAG 1 cut(s) 222
BstKTI GATC 3 cut(s) 109, 200, 237
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 3 cut(s) 106, 197, 234
BstV1I GCAGC 1 cut(s) 62
CviJI RGCY 1 cut(s) 226
CviKI_1 RGCY 1 cut(s) 226
DdeI CTNAG 1 cut(s) 222
DpnI GATC 3 cut(s) 108, 199, 236
DpnII GATC 3 cut(s) 106, 197, 234
FaiI YATR 3 cut(s) 143, 159, 164
Fnu4HI GCNGC 1 cut(s) 51
Fsp4HI GCNGC 1 cut(s) 51
FspBI CTAG 1 cut(s) 60
GluI GCNGC 1 cut(s) 51
HinfI GANTC 1 cut(s) 37
Hpy188III TCNNGA 3 cut(s) 110, 168, 201
HpyAV CCTTC 2 cut(s) 29, 198
HpyCH4V TGCA 1 cut(s) 101
HpyF3I CTNAG 1 cut(s) 222
Kzo9I GATC 3 cut(s) 106, 197, 234
LpnPI CCDG 3 cut(s) 47, 54, 110
Lsp1109I GCAGC 1 cut(s) 62
LweI GCATC 1 cut(s) 227
MaeI CTAG 1 cut(s) 60
MalI GATC 3 cut(s) 108, 199, 236
MboI GATC 3 cut(s) 106, 197, 234
MluCI AATT 1 cut(s) 135
MnlI CCTC 1 cut(s) 97
NdeII GATC 3 cut(s) 106, 197, 234
PfeI GAWTC 1 cut(s) 37
PkrI GCNGC 1 cut(s) 52
SatI GCNGC 1 cut(s) 51
Sau3AI GATC 3 cut(s) 106, 197, 234
SetI ASST 4 cut(s) 8, 187, 209, 228
SfaNI GCATC 1 cut(s) 227
SgeI CNNG 9 cut(s) 46, 53, 72, 101, 122, 137, 180, 194, 213
Sse9I AATT 1 cut(s) 135
SspMI CTAG 1 cut(s) 60
TaqI TCGA 1 cut(s) 237
TasI AATT 1 cut(s) 135
TfiI GAWTC 1 cut(s) 37
TseI GCWGC 1 cut(s) 50
TspGWI ACGGA 1 cut(s) 190
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.