Rroxscaffold_6G00426500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
OG0000937
Physical Location & Seq
Reverse (-)
47223113 .. 47227140
4028 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00426500.1

Sequence Viewer

Length: 276 bp
ATGGCAACAAAAACTGGAAGAACAAAGATGATGAGACTTTTACGAGATGATGATGCAGAGGATCAAGGTAGTCAAAGACAGGGAGAGAGAATATCTGATTATCAAGCTTTGGTTGCTGTTTTTGATATGGACACACATTCTCAGATTATATCAAAAAAGCAGAAACAAGGTCTCAGTTATGCTCCATTCGAGTCATCGTCTCAGAAATACTTGACGGACAATGGGAGTGTCTTTATGACCAAGGTGGGTATTTCATTATCAATGGTAGTGAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.24

Weight (kDa)

9.05

Isoelectric Point (pI)

37.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 69
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
Alw26I GTCTC 3 cut(s) 28, 176, 204
AlwI GGATC 1 cut(s) 69
BcoDI GTCTC 3 cut(s) 28, 176, 204
BmsI GCATC 1 cut(s) 43
BsaI GGTCTC 1 cut(s) 176
BsaJI CCNNGG 1 cut(s) 240
Bse1I ACTGG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 240
BseMII CTCAG 3 cut(s) 155, 187, 215
BseNI ACTGG 1 cut(s) 19
BsmAI GTCTC 3 cut(s) 28, 176, 204
BsmBI CGTCTC 1 cut(s) 204
Bso31I GGTCTC 1 cut(s) 176
Bsp143I GATC 1 cut(s) 61
BspCNI CTCAG 3 cut(s) 154, 186, 214
BspPI GGATC 1 cut(s) 69
BspTNI GGTCTC 1 cut(s) 176
BsrI ACTGG 1 cut(s) 19
BssECI CCNNGG 1 cut(s) 240
BssMI GATC 1 cut(s) 61
BssT1I CCWWGG 1 cut(s) 240
BstDEI CTNAG 3 cut(s) 141, 173, 201
BstKTI GATC 1 cut(s) 64
BstMAI GTCTC 3 cut(s) 28, 176, 204
BstMBI GATC 1 cut(s) 61
BstMWI GCNNNNNNNGC 1 cut(s) 113
CviJI RGCY 1 cut(s) 107
CviKI_1 RGCY 1 cut(s) 107
DdeI CTNAG 3 cut(s) 141, 173, 201
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
Eco130I CCWWGG 1 cut(s) 240
Eco31I GGTCTC 1 cut(s) 176
EcoT14I CCWWGG 1 cut(s) 240
ErhI CCWWGG 1 cut(s) 240
Esp3I CGTCTC 1 cut(s) 204
FaiI YATR 4 cut(s) 128, 149, 180, 236
HindIII AAGCTT 1 cut(s) 105
HinfI GANTC 1 cut(s) 191
Hpy188I TCNGA 3 cut(s) 97, 144, 204
HpyCH4V TGCA 1 cut(s) 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 113
HpyF3I CTNAG 3 cut(s) 141, 173, 201
Kzo9I GATC 1 cut(s) 61
LmnI GCTCC 1 cut(s) 187
LpnPI CCDG 1 cut(s) 65
LweI GCATC 1 cut(s) 43
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 30
MlyI GAGTC 1 cut(s) 200
MnlI CCTC 2 cut(s) 52, 264
MwoI GCNNNNNNNGC 1 cut(s) 113
NdeII GATC 1 cut(s) 61
PleI GAGTC 1 cut(s) 199
PpsI GAGTC 1 cut(s) 199
Sau3AI GATC 1 cut(s) 61
SchI GAGTC 1 cut(s) 200
SetI ASST 5 cut(s) 70, 109, 172, 246, 275
SfaNI GCATC 1 cut(s) 43
SgeI CNNG 9 cut(s) 27, 56, 77, 92, 116, 179, 202, 223, 253
StyI CCWWGG 1 cut(s) 240
TaqI TCGA 1 cut(s) 189
TspDTI ATGAA 1 cut(s) 243
TspGWI ACGGA 1 cut(s) 230
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.