Rh4AG190200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0000937
Physical Location & Seq
Reverse (-)
47113184 .. 47118919
5736 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG190200.1

Sequence Viewer

Length: 231 bp
ATGGAGGATACGCTGAAAGAAAGTTTCAATGGCCAAAACAAGATGAGGTTGAACCACACCCTTTACCACCTCCAGAATCCAGTAATGGCAGCAAAAACTGGAAAGACAAAGATGATGAGACTTCTACGAGATGATAATGCAGAGGATCAAGATACTCAAAGACAGGCAGAGAGAATTGATATGGACACACATTCTCAGATTATATCAAGAAAGCGGAAACAAGGTAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

76

Amino Acids

8.97

Weight (kDa)

9.69

Isoelectric Point (pI)

42.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 214
AclWI GGATC 1 cut(s) 153
AcoI YGGCCR 1 cut(s) 31
AgsI TTSAA 2 cut(s) 28, 52
Alw26I GTCTC 1 cut(s) 112
AlwI GGATC 1 cut(s) 153
AoxI GGCC 1 cut(s) 31
ApeKI GCWGC 1 cut(s) 89
BalI TGGCCA 1 cut(s) 33
BbvI GCAGC 1 cut(s) 101
BcoDI GTCTC 1 cut(s) 112
BisI GCNGC 1 cut(s) 90
BlsI GCNGC 1 cut(s) 91
BpmI CTGGAG 1 cut(s) 56
Bse1I ACTGG 2 cut(s) 80, 103
BseMII CTCAG 1 cut(s) 209
BseNI ACTGG 2 cut(s) 80, 103
BseXI GCAGC 1 cut(s) 101
BshFI GGCC 1 cut(s) 33
BsmAI GTCTC 1 cut(s) 112
BsnI GGCC 1 cut(s) 33
Bsp143I GATC 1 cut(s) 145
BspACI CCGC 1 cut(s) 214
BspANI GGCC 1 cut(s) 33
BspCNI CTCAG 1 cut(s) 208
BspPI GGATC 1 cut(s) 153
BsrI ACTGG 2 cut(s) 80, 103
BssMI GATC 1 cut(s) 145
BstDEI CTNAG 1 cut(s) 195
BstKTI GATC 1 cut(s) 148
BstMAI GTCTC 1 cut(s) 112
BstMBI GATC 1 cut(s) 145
BstV1I GCAGC 1 cut(s) 101
BsuRI GGCC 1 cut(s) 33
CviJI RGCY 1 cut(s) 33
CviKI_1 RGCY 1 cut(s) 33
DdeI CTNAG 1 cut(s) 195
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
EaeI YGGCCR 1 cut(s) 31
FaiI YATR 2 cut(s) 182, 203
Fnu4HI GCNGC 1 cut(s) 90
Fsp4HI GCNGC 1 cut(s) 90
GluI GCNGC 1 cut(s) 90
GsuI CTGGAG 1 cut(s) 56
HaeIII GGCC 1 cut(s) 33
HinfI GANTC 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 198
Hpy188III TCNNGA 3 cut(s) 73, 149, 207
HpyCH4V TGCA 1 cut(s) 140
HpyF3I CTNAG 1 cut(s) 195
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 4 cut(s) 84, 86, 93, 149
Lsp1109I GCAGC 1 cut(s) 101
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MlsI TGGCCA 1 cut(s) 33
MluCI AATT 1 cut(s) 174
MluNI TGGCCA 1 cut(s) 33
MnlI CCTC 3 cut(s) 39, 80, 136
Mox20I TGGCCA 1 cut(s) 33
MscI TGGCCA 1 cut(s) 33
Msp20I TGGCCA 1 cut(s) 33
NdeII GATC 1 cut(s) 145
PfeI GAWTC 1 cut(s) 76
PkrI GCNGC 1 cut(s) 91
SatI GCNGC 1 cut(s) 90
Sau3AI GATC 1 cut(s) 145
SetI ASST 3 cut(s) 50, 72, 226
SgeI CNNG 8 cut(s) 52, 85, 92, 111, 140, 161, 176, 219
Sse9I AATT 1 cut(s) 174
SsiI CCGC 1 cut(s) 214
TasI AATT 1 cut(s) 174
TfiI GAWTC 1 cut(s) 76
TseI GCWGC 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.