RchiOBHm_Chr4g0419681

RNA binding

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
45207150 .. 45210643
3494 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38954

Sequence Viewer

Length: 444 bp
ATGTCTATTGCTTTGGACAGAAATGGGAATAGTGGGAATGGTATGATCCCACGATCCGGGAGGTTCATCCATGGGATGCCTTGTATTTCGATCTACGTCACAAAAGGGTTTGATCAGGATCGTCGTTTGGAGTTGGAGGAGAACTCTAGTAGCTCGAGGTCCTCGTCGGTTGGTAATAACAGTGACGAGTCTAATGGGTCGTCGGAGGGTGAGGTTCAGAGCTCGTTTAAAGGGCCTTTGGACACCATGGACCAGCTTGAGGAGGTTTTGCCTGTCAATATGACCAAGTTGAGGAAGCTAAACCGAACTATGGCTCATCGCCTGTCCATGCTGACGACACAAGTGTCGCAGTTGGTGAAGATCGAACACATTGAAACCACGGTTGCCAAGATCGATCAGTTTGCACCTTCTAAACAAGATAAGAGCAAGCGCTCCGAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

147

Amino Acids

16.3

Weight (kDa)

6.84

Isoelectric Point (pI)

60.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 343
AclWI GGATC 3 cut(s) 40, 48, 126
AfeI AGCGCT 1 cut(s) 431
AfiI CCNNNNNNNGG 4 cut(s) 56, 259, 291, 310
AgsI TTSAA 1 cut(s) 374
AluBI AGCT 4 cut(s) 153, 222, 256, 298
AluI AGCT 4 cut(s) 153, 222, 256, 298
Alw21I GWGCWC 1 cut(s) 224
AlwI GGATC 3 cut(s) 40, 48, 126
Ama87I CYCGRG 1 cut(s) 154
Aor51HI AGCGCT 1 cut(s) 431
AoxI GGCC 1 cut(s) 233
AspLEI GCGC 1 cut(s) 432
AspS9I GGNCC 3 cut(s) 159, 233, 250
AsuC2I CCSGG 1 cut(s) 58
AsuHPI GGTGA 2 cut(s) 221, 367
AvaI CYCGRG 1 cut(s) 154
AvaII GGWCC 2 cut(s) 159, 250
BanII GRGCYC 1 cut(s) 224
Bbv12I GWGCWC 1 cut(s) 224
BcgI CGANNNNNNTGC 2 cut(s) 383, 417
BclI TGATCA 1 cut(s) 112
BcnI CCSGG 1 cut(s) 58
BfaI CTAG 1 cut(s) 147
BfoI RGCGCY 1 cut(s) 433
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 2 cut(s) 159, 250
BmeT110I CYCGRG 1 cut(s) 154
BmgT120I GGNCC 3 cut(s) 159, 233, 250
BmrFI CCNGG 1 cut(s) 58
BmsI GCATC 1 cut(s) 66
BplI GAGNNNNNCTC 2 cut(s) 128, 160
BpuEI CTTGAG 1 cut(s) 278
BpuMI CCSGG 1 cut(s) 58
Bsa29I ATCGAT 1 cut(s) 393
BsaBI GATNNNNATC 1 cut(s) 117
BsaJI CCNNGG 3 cut(s) 70, 246, 378
Bsc4I CCNNNNNNNGG 4 cut(s) 56, 259, 291, 310
Bse8I GATNNNNATC 1 cut(s) 117
BseCI ATCGAT 1 cut(s) 393
BseDI CCNNGG 3 cut(s) 70, 246, 378
BseGI GGATG 2 cut(s) 66, 81
BseJI GATNNNNATC 1 cut(s) 117
BseLI CCNNNNNNNGG 4 cut(s) 56, 259, 291, 310
BseRI GAGGAG 2 cut(s) 152, 275
BshFI GGCC 1 cut(s) 235
BshVI ATCGAT 1 cut(s) 393
BsiHKAI GWGCWC 1 cut(s) 224
BsiHKCI CYCGRG 1 cut(s) 154
BsiSI CCGG 1 cut(s) 57
BslI CCNNNNNNNGG 4 cut(s) 56, 259, 291, 310
BsnI GGCC 1 cut(s) 235
BsoBI CYCGRG 1 cut(s) 154
Bsp1286I GDGCHC 1 cut(s) 224
Bsp143I GATC 8 cut(s) 45, 53, 90, 112, 118, 360, 390, 394
Bsp19I CCATGG 2 cut(s) 70, 246
BspANI GGCC 1 cut(s) 235
BspDI ATCGAT 1 cut(s) 393
BspPI GGATC 3 cut(s) 40, 48, 126
BssECI CCNNGG 3 cut(s) 70, 246, 378
BssMI GATC 8 cut(s) 45, 53, 90, 112, 118, 360, 390, 394
BssT1I CCWWGG 2 cut(s) 70, 246
Bst4CI ACNGT 2 cut(s) 182, 382
BstC8I GCNNGC 1 cut(s) 428
BstDSI CCRYGG 3 cut(s) 70, 246, 378
BstF5I GGATG 2 cut(s) 66, 81
BstH2I RGCGCY 1 cut(s) 433
BstHHI GCGC 1 cut(s) 432
BstKTI GATC 8 cut(s) 48, 56, 93, 115, 121, 363, 393, 397
BstMBI GATC 8 cut(s) 45, 53, 90, 112, 118, 360, 390, 394
BstSCI CCNGG 1 cut(s) 56
Bsu15I ATCGAT 1 cut(s) 393
BsuRI GGCC 1 cut(s) 235
BsuTUI ATCGAT 1 cut(s) 393
BtgI CCRYGG 3 cut(s) 70, 246, 378
BtgZI GCGATG 1 cut(s) 302
BtsCI GGATG 2 cut(s) 66, 81
BtsIMutI CAGTG 1 cut(s) 187
Cac8I GCNNGC 1 cut(s) 428
CfoI GCGC 1 cut(s) 432
Cfr13I GGNCC 3 cut(s) 159, 233, 250
ClaI ATCGAT 1 cut(s) 393
CviAII CATG 3 cut(s) 71, 247, 328
CviJI RGCY 6 cut(s) 153, 222, 235, 256, 298, 314
CviKI_1 RGCY 6 cut(s) 153, 222, 235, 256, 298, 314
DpnI GATC 8 cut(s) 47, 55, 92, 114, 120, 362, 392, 396
DpnII GATC 8 cut(s) 45, 53, 90, 112, 118, 360, 390, 394
DraI TTTAAA 1 cut(s) 229
DrdI GACNNNNNNGTC 1 cut(s) 343
DseDI GACNNNNNNGTC 1 cut(s) 343
Ecl136II GAGCTC 1 cut(s) 222
Eco130I CCWWGG 2 cut(s) 70, 246
Eco24I GRGCYC 1 cut(s) 224
Eco47I GGWCC 2 cut(s) 159, 250
Eco47III AGCGCT 1 cut(s) 431
Eco53kI GAGCTC 1 cut(s) 222
Eco88I CYCGRG 1 cut(s) 154
EcoICRI GAGCTC 1 cut(s) 222
EcoO109I RGGNCCY 2 cut(s) 159, 233
EcoT14I CCWWGG 2 cut(s) 70, 246
EcoT38I GRGCYC 1 cut(s) 224
ErhI CCWWGG 2 cut(s) 70, 246
FaeI CATG 3 cut(s) 74, 250, 331
FaiI YATR 6 cut(s) 44, 72, 248, 281, 311, 329
FatI CATG 3 cut(s) 70, 246, 327
FbaI TGATCA 1 cut(s) 112
FokI GGATG 2 cut(s) 53, 88
FriOI GRGCYC 1 cut(s) 224
FspBI CTAG 1 cut(s) 147
GlaI GCGC 1 cut(s) 431
HaeII RGCGCY 1 cut(s) 433
HaeIII GGCC 1 cut(s) 235
HapII CCGG 1 cut(s) 57
HhaI GCGC 1 cut(s) 432
Hin1II CATG 3 cut(s) 74, 250, 331
Hin6I GCGC 1 cut(s) 430
HinP1I GCGC 1 cut(s) 430
HinfI GANTC 1 cut(s) 188
HpaII CCGG 1 cut(s) 57
HphI GGTGA 2 cut(s) 221, 367
Hpy188I TCNGA 3 cut(s) 205, 219, 436
Hpy188III TCNNGA 1 cut(s) 116
Hpy99I CGWCG 3 cut(s) 126, 169, 205
HpyAV CCTTC 1 cut(s) 417
HpyCH4III ACNGT 2 cut(s) 182, 382
HpyCH4IV ACGT 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 404
HpySE526I ACGT 1 cut(s) 96
Hsp92II CATG 3 cut(s) 74, 250, 331
HspAI GCGC 1 cut(s) 430
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 8 cut(s) 45, 53, 90, 112, 118, 360, 390, 394
LmnI GCTCC 1 cut(s) 437
LpnPI CCDG 5 cut(s) 70, 101, 266, 285, 335
LweI GCATC 1 cut(s) 66
MaeI CTAG 1 cut(s) 147
MaeII ACGT 1 cut(s) 96
MaeIII GTNAC 2 cut(s) 97, 182
MalI GATC 8 cut(s) 47, 55, 92, 114, 120, 362, 392, 396
MboI GATC 8 cut(s) 45, 53, 90, 112, 118, 360, 390, 394
MboII GAAGA 1 cut(s) 370
MhlI GDGCHC 1 cut(s) 224
MlyI GAGTC 1 cut(s) 197
MmeI TCCRAC 2 cut(s) 114, 183
MnlI CCTC 9 cut(s) 54, 130, 150, 172, 199, 205, 253, 256, 285
MseI TTAA 1 cut(s) 228
MspI CCGG 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 58
NciI CCSGG 1 cut(s) 58
NcoI CCATGG 2 cut(s) 70, 246
NdeII GATC 8 cut(s) 45, 53, 90, 112, 118, 360, 390, 394
NlaIII CATG 3 cut(s) 74, 250, 331
NmuCI GTSAC 2 cut(s) 97, 182
PaeR7I CTCGAG 1 cut(s) 154
PcsI WCGNNNNNNNCGW 1 cut(s) 161
PfoI TCCNGGA 1 cut(s) 56
PleI GAGTC 1 cut(s) 196
PpsI GAGTC 1 cut(s) 196
PpuMI RGGWCCY 1 cut(s) 159
Psp124BI GAGCTC 1 cut(s) 224
Psp5II RGGWCCY 1 cut(s) 159
PspPI GGNCC 3 cut(s) 159, 233, 250
PspPPI RGGWCCY 1 cut(s) 159
PspXI VCTCGAGB 1 cut(s) 154
SacI GAGCTC 1 cut(s) 224
SaqAI TTAA 1 cut(s) 228
Sau3AI GATC 8 cut(s) 45, 53, 90, 112, 118, 360, 390, 394
Sau96I GGNCC 3 cut(s) 159, 233, 250
SchI GAGTC 1 cut(s) 197
ScrFI CCNGG 1 cut(s) 58
SduI GDGCHC 1 cut(s) 224
SfaNI GCATC 1 cut(s) 66
Sfr274I CTCGAG 1 cut(s) 154
SinI GGWCC 2 cut(s) 159, 250
SlaI CTCGAG 1 cut(s) 154
SmlI CTYRAG 2 cut(s) 154, 257
SmoI CTYRAG 2 cut(s) 154, 257
SspMI CTAG 1 cut(s) 147
SstI GAGCTC 1 cut(s) 224
StyD4I CCNGG 1 cut(s) 56
StyI CCWWGG 2 cut(s) 70, 246
TaaI ACNGT 2 cut(s) 182, 382
TaiI ACGT 1 cut(s) 99
TaqI TCGA 4 cut(s) 89, 155, 363, 393
Tru1I TTAA 1 cut(s) 228
Tru9I TTAA 1 cut(s) 228
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 2 cut(s) 97, 182
Tsp45I GTSAC 2 cut(s) 97, 182
TspDTI ATGAA 1 cut(s) 55
TspRI CASTG 1 cut(s) 187
VpaK11BI GGWCC 2 cut(s) 159, 250
XhoI CTCGAG 1 cut(s) 154
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.