Rmu_sc0000726.1_g000004

RNA binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000726.1
Physical Location & Seq
Forward (+)
15180 .. 15470
291 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000726.1_g000004.1.cds

Sequence Viewer

Length: 291 bp
atgtctattgctttggacagaaatgggaatagtgggaatggtatgatcccacggtccgggagattcatccatgggatgccttgtattttgatctacgacacaaaagggtttgatcaggatcgtcgtttggagttggaggaggactctagtagctcgaggtcctcgtcggttggtaataacagtgacgagtctaatgggtcgtcggagggtgaggagggtgaggttcagagctcgtttaaagggcctttggacaccatggaccagcttgaggaggttttgcctgtcaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.43

Weight (kDa)

4.39

Isoelectric Point (pI)

66.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 40, 126
AfiI CCNNNNNNNGG 2 cut(s) 56, 268
AluBI AGCT 3 cut(s) 153, 231, 265
AluI AGCT 3 cut(s) 153, 231, 265
Alw21I GWGCWC 1 cut(s) 233
AlwI GGATC 2 cut(s) 40, 126
Ama87I CYCGRG 1 cut(s) 154
AoxI GGCC 1 cut(s) 242
AspS9I GGNCC 4 cut(s) 54, 159, 242, 259
AsuC2I CCSGG 1 cut(s) 58
AsuHPI GGTGA 2 cut(s) 221, 230
AvaI CYCGRG 1 cut(s) 154
AvaII GGWCC 3 cut(s) 54, 159, 259
BanII GRGCYC 1 cut(s) 233
Bbv12I GWGCWC 1 cut(s) 233
BclI TGATCA 1 cut(s) 112
BcnI CCSGG 1 cut(s) 58
BfaI CTAG 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 3 cut(s) 54, 159, 259
BmeT110I CYCGRG 1 cut(s) 154
BmgT120I GGNCC 4 cut(s) 54, 159, 242, 259
BmrFI CCNGG 1 cut(s) 58
BmsI GCATC 1 cut(s) 66
BplI GAGNNNNNCTC 2 cut(s) 128, 160
BpuEI CTTGAG 1 cut(s) 287
BpuMI CCSGG 1 cut(s) 58
BsaBI GATNNNNATC 1 cut(s) 117
BsaJI CCNNGG 3 cut(s) 50, 70, 255
Bsc4I CCNNNNNNNGG 2 cut(s) 56, 268
Bse8I GATNNNNATC 1 cut(s) 117
BseDI CCNNGG 3 cut(s) 50, 70, 255
BseGI GGATG 2 cut(s) 66, 81
BseJI GATNNNNATC 1 cut(s) 117
BseLI CCNNNNNNNGG 2 cut(s) 56, 268
BseRI GAGGAG 3 cut(s) 152, 227, 284
BshFI GGCC 1 cut(s) 244
BsiHKAI GWGCWC 1 cut(s) 233
BsiHKCI CYCGRG 1 cut(s) 154
BsiSI CCGG 1 cut(s) 57
BslI CCNNNNNNNGG 2 cut(s) 56, 268
BsnI GGCC 1 cut(s) 244
BsoBI CYCGRG 1 cut(s) 154
Bsp1286I GDGCHC 1 cut(s) 233
Bsp143I GATC 4 cut(s) 45, 90, 112, 118
Bsp19I CCATGG 2 cut(s) 70, 255
BspANI GGCC 1 cut(s) 244
BspPI GGATC 2 cut(s) 40, 126
BssECI CCNNGG 3 cut(s) 50, 70, 255
BssMI GATC 4 cut(s) 45, 90, 112, 118
BssT1I CCWWGG 2 cut(s) 70, 255
Bst4CI ACNGT 2 cut(s) 54, 182
BstDSI CCRYGG 3 cut(s) 50, 70, 255
BstF5I GGATG 2 cut(s) 66, 81
BstKTI GATC 4 cut(s) 48, 93, 115, 121
BstMBI GATC 4 cut(s) 45, 90, 112, 118
BstSCI CCNGG 1 cut(s) 56
BsuRI GGCC 1 cut(s) 244
BtgI CCRYGG 3 cut(s) 50, 70, 255
BtsCI GGATG 2 cut(s) 66, 81
BtsIMutI CAGTG 1 cut(s) 187
Cfr13I GGNCC 4 cut(s) 54, 159, 242, 259
CpoI CGGWCCG 1 cut(s) 54
CspI CGGWCCG 1 cut(s) 54
CviAII CATG 2 cut(s) 71, 256
CviJI RGCY 4 cut(s) 153, 231, 244, 265
CviKI_1 RGCY 4 cut(s) 153, 231, 244, 265
DpnI GATC 4 cut(s) 47, 92, 114, 120
DpnII GATC 4 cut(s) 45, 90, 112, 118
DraI TTTAAA 1 cut(s) 238
Ecl136II GAGCTC 1 cut(s) 231
Eco130I CCWWGG 2 cut(s) 70, 255
Eco24I GRGCYC 1 cut(s) 233
Eco47I GGWCC 3 cut(s) 54, 159, 259
Eco53kI GAGCTC 1 cut(s) 231
Eco88I CYCGRG 1 cut(s) 154
EcoICRI GAGCTC 1 cut(s) 231
EcoO109I RGGNCCY 2 cut(s) 159, 242
EcoT14I CCWWGG 2 cut(s) 70, 255
EcoT38I GRGCYC 1 cut(s) 233
ErhI CCWWGG 2 cut(s) 70, 255
FaeI CATG 2 cut(s) 74, 259
FaiI YATR 3 cut(s) 44, 72, 257
FatI CATG 2 cut(s) 70, 255
FbaI TGATCA 1 cut(s) 112
FokI GGATG 2 cut(s) 53, 88
FriOI GRGCYC 1 cut(s) 233
FspBI CTAG 1 cut(s) 147
HaeIII GGCC 1 cut(s) 244
HapII CCGG 1 cut(s) 57
Hin1II CATG 2 cut(s) 74, 259
HinfI GANTC 3 cut(s) 63, 143, 188
HpaII CCGG 1 cut(s) 57
HphI GGTGA 2 cut(s) 221, 230
Hpy188I TCNGA 2 cut(s) 205, 228
Hpy188III TCNNGA 1 cut(s) 116
Hpy99I CGWCG 3 cut(s) 126, 169, 205
HpyCH4III ACNGT 2 cut(s) 54, 182
Hsp92II CATG 2 cut(s) 74, 259
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 4 cut(s) 45, 90, 112, 118
LpnPI CCDG 3 cut(s) 70, 101, 275
LweI GCATC 1 cut(s) 66
MaeI CTAG 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 182
MalI GATC 4 cut(s) 47, 92, 114, 120
MboI GATC 4 cut(s) 45, 90, 112, 118
MhlI GDGCHC 1 cut(s) 233
MlyI GAGTC 2 cut(s) 137, 197
MmeI TCCRAC 2 cut(s) 114, 183
MseI TTAA 1 cut(s) 237
MspI CCGG 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 58
NciI CCSGG 1 cut(s) 58
NcoI CCATGG 2 cut(s) 70, 255
NdeII GATC 4 cut(s) 45, 90, 112, 118
NlaIII CATG 2 cut(s) 74, 259
NmuCI GTSAC 1 cut(s) 182
PaeR7I CTCGAG 1 cut(s) 154
PcsI WCGNNNNNNNCGW 1 cut(s) 161
PfeI GAWTC 1 cut(s) 63
PfoI TCCNGGA 1 cut(s) 56
PleI GAGTC 2 cut(s) 137, 196
PpsI GAGTC 2 cut(s) 137, 196
PpuMI RGGWCCY 1 cut(s) 159
Psp124BI GAGCTC 1 cut(s) 233
Psp5II RGGWCCY 1 cut(s) 159
PspPI GGNCC 4 cut(s) 54, 159, 242, 259
PspPPI RGGWCCY 1 cut(s) 159
PspXI VCTCGAGB 1 cut(s) 154
Rsr2I CGGWCCG 1 cut(s) 54
RsrII CGGWCCG 1 cut(s) 54
SacI GAGCTC 1 cut(s) 233
SaqAI TTAA 1 cut(s) 237
Sau3AI GATC 4 cut(s) 45, 90, 112, 118
Sau96I GGNCC 4 cut(s) 54, 159, 242, 259
SchI GAGTC 2 cut(s) 137, 197
ScrFI CCNGG 1 cut(s) 58
SduI GDGCHC 1 cut(s) 233
SetI ASST 6 cut(s) 155, 161, 225, 233, 267, 276
SfaNI GCATC 1 cut(s) 66
Sfr274I CTCGAG 1 cut(s) 154
SinI GGWCC 3 cut(s) 54, 159, 259
SlaI CTCGAG 1 cut(s) 154
SmlI CTYRAG 2 cut(s) 154, 266
SmoI CTYRAG 2 cut(s) 154, 266
SspMI CTAG 1 cut(s) 147
SstI GAGCTC 1 cut(s) 233
StyD4I CCNGG 1 cut(s) 56
StyI CCWWGG 2 cut(s) 70, 255
TaaI ACNGT 2 cut(s) 54, 182
TaqI TCGA 1 cut(s) 155
TfiI GAWTC 1 cut(s) 63
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 1 cut(s) 55
TspRI CASTG 1 cut(s) 187
VpaK11BI GGWCC 3 cut(s) 54, 159, 259
XhoI CTCGAG 1 cut(s) 154
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.