Rh3AG144800

Belongs to the bacterial ribosomal protein bL17 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
12841061 .. 12844308
3248 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG144800.1

Sequence Viewer

Length: 312 bp
ATGGGATGCCTTGTATTTCGATCTACGACACAAAAGGGTTTGATCAGGATCGTCGTTTGGAGTTGGAGGAGGACTCTAGTAGCTCGAGGTCCTCGTCGGTTGGTAATAACAGTGACGAGTCTAATGGGTAATCTTGAGATAGGGAGTATGACCAAGTTGAGGAAGCTAAACCGAACTATGGCTCATCGCCTGTCCATGCTGACGACACAGGTGTCGCAGTTGGTGAAGATCGAACGCATTGAAACCACGGTTGCCAAGATCGACCAGTTTGCACCTTCTAAACAAGATAAGAGAAAGCGCTCCGAGATTTGA

Protein Analysis

103

Amino Acids

11.87

Weight (kDa)

11.81

Isoelectric Point (pI)

51.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 211
AclWI GGATC 1 cut(s) 56
AfeI AGCGCT 1 cut(s) 299
AfiI CCNNNNNNNGG 2 cut(s) 159, 178
AgsI TTSAA 1 cut(s) 242
AluBI AGCT 2 cut(s) 83, 166
AluI AGCT 2 cut(s) 83, 166
AlwI GGATC 1 cut(s) 56
Ama87I CYCGRG 1 cut(s) 84
Aor51HI AGCGCT 1 cut(s) 299
AspLEI GCGC 1 cut(s) 300
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 235
AvaI CYCGRG 1 cut(s) 84
AvaII GGWCC 1 cut(s) 89
BcgI CGANNNNNNTGC 2 cut(s) 251, 285
BclI TGATCA 1 cut(s) 42
BfaI CTAG 1 cut(s) 77
BfoI RGCGCY 1 cut(s) 301
Bme18I GGWCC 1 cut(s) 89
BmeT110I CYCGRG 1 cut(s) 84
BmgT120I GGNCC 1 cut(s) 89
BplI GAGNNNNNCTC 2 cut(s) 58, 90
BpuEI CTTGAG 1 cut(s) 155
BsaBI GATNNNNATC 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 246
Bsc4I CCNNNNNNNGG 2 cut(s) 159, 178
Bse1I ACTGG 1 cut(s) 265
Bse8I GATNNNNATC 1 cut(s) 47
BseDI CCNNGG 1 cut(s) 246
BseGI GGATG 1 cut(s) 11
BseJI GATNNNNATC 1 cut(s) 47
BseLI CCNNNNNNNGG 2 cut(s) 159, 178
BseNI ACTGG 1 cut(s) 265
BseRI GAGGAG 1 cut(s) 82
BsiHKCI CYCGRG 1 cut(s) 84
BslI CCNNNNNNNGG 2 cut(s) 159, 178
BsoBI CYCGRG 1 cut(s) 84
Bsp143I GATC 5 cut(s) 20, 42, 48, 228, 258
BspPI GGATC 1 cut(s) 56
BsrI ACTGG 1 cut(s) 265
BssECI CCNNGG 1 cut(s) 246
BssMI GATC 5 cut(s) 20, 42, 48, 228, 258
Bst4CI ACNGT 2 cut(s) 112, 250
BstDSI CCRYGG 1 cut(s) 246
BstF5I GGATG 1 cut(s) 11
BstH2I RGCGCY 1 cut(s) 301
BstHHI GCGC 1 cut(s) 300
BstKTI GATC 5 cut(s) 23, 45, 51, 231, 261
BstMBI GATC 5 cut(s) 20, 42, 48, 228, 258
BtgI CCRYGG 1 cut(s) 246
BtgZI GCGATG 1 cut(s) 170
BtsCI GGATG 1 cut(s) 11
BtsIMutI CAGTG 1 cut(s) 117
CfoI GCGC 1 cut(s) 300
Cfr13I GGNCC 1 cut(s) 89
CviAII CATG 1 cut(s) 196
CviJI RGCY 3 cut(s) 83, 166, 182
CviKI_1 RGCY 3 cut(s) 83, 166, 182
DpnI GATC 5 cut(s) 22, 44, 50, 230, 260
DpnII GATC 5 cut(s) 20, 42, 48, 228, 258
DrdI GACNNNNNNGTC 1 cut(s) 211
DseDI GACNNNNNNGTC 1 cut(s) 211
Eco47I GGWCC 1 cut(s) 89
Eco47III AGCGCT 1 cut(s) 299
Eco88I CYCGRG 1 cut(s) 84
EcoO109I RGGNCCY 1 cut(s) 89
FaeI CATG 1 cut(s) 199
FaiI YATR 3 cut(s) 149, 179, 197
FatI CATG 1 cut(s) 195
FbaI TGATCA 1 cut(s) 42
FokI GGATG 1 cut(s) 18
FspBI CTAG 1 cut(s) 77
GlaI GCGC 1 cut(s) 299
HaeII RGCGCY 1 cut(s) 301
HhaI GCGC 1 cut(s) 300
Hin1II CATG 1 cut(s) 199
Hin6I GCGC 1 cut(s) 298
HinP1I GCGC 1 cut(s) 298
HinfI GANTC 2 cut(s) 73, 118
HphI GGTGA 1 cut(s) 235
Hpy188I TCNGA 1 cut(s) 304
Hpy188III TCNNGA 2 cut(s) 46, 134
Hpy99I CGWCG 2 cut(s) 56, 99
HpyAV CCTTC 1 cut(s) 285
HpyCH4III ACNGT 2 cut(s) 112, 250
HpyCH4V TGCA 1 cut(s) 272
Hsp92II CATG 1 cut(s) 199
HspAI GCGC 1 cut(s) 298
Ksp22I TGATCA 1 cut(s) 42
Kzo9I GATC 5 cut(s) 20, 42, 48, 228, 258
LmnI GCTCC 1 cut(s) 305
LpnPI CCDG 4 cut(s) 31, 194, 203, 278
MaeI CTAG 1 cut(s) 77
MaeIII GTNAC 1 cut(s) 112
MalI GATC 5 cut(s) 22, 44, 50, 230, 260
MboI GATC 5 cut(s) 20, 42, 48, 228, 258
MboII GAAGA 1 cut(s) 238
MlyI GAGTC 2 cut(s) 67, 127
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 5 cut(s) 60, 63, 80, 102, 153
NdeII GATC 5 cut(s) 20, 42, 48, 228, 258
NlaIII CATG 1 cut(s) 199
NmuCI GTSAC 1 cut(s) 112
PaeR7I CTCGAG 1 cut(s) 84
PcsI WCGNNNNNNNCGW 1 cut(s) 91
PleI GAGTC 2 cut(s) 67, 126
PpsI GAGTC 2 cut(s) 67, 126
PpuMI RGGWCCY 1 cut(s) 89
Psp5II RGGWCCY 1 cut(s) 89
PspPI GGNCC 1 cut(s) 89
PspPPI RGGWCCY 1 cut(s) 89
PspXI VCTCGAGB 1 cut(s) 84
Sau3AI GATC 5 cut(s) 20, 42, 48, 228, 258
Sau96I GGNCC 1 cut(s) 89
SchI GAGTC 2 cut(s) 67, 127
SetI ASST 5 cut(s) 85, 91, 168, 213, 277
Sfr274I CTCGAG 1 cut(s) 84
SinI GGWCC 1 cut(s) 89
SlaI CTCGAG 1 cut(s) 84
SmlI CTYRAG 2 cut(s) 84, 134
SmoI CTYRAG 2 cut(s) 84, 134
SspMI CTAG 1 cut(s) 77
TaaI ACNGT 2 cut(s) 112, 250
TaqI TCGA 4 cut(s) 19, 85, 231, 261
TscAI CASTG 1 cut(s) 117
TseFI GTSAC 1 cut(s) 112
Tsp45I GTSAC 1 cut(s) 112
TspRI CASTG 1 cut(s) 117
VpaK11BI GGWCC 1 cut(s) 89
XhoI CTCGAG 1 cut(s) 84
XspI CTAG 1 cut(s) 77
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.