Rh2DG283600

RNA binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
OG0000728
Physical Location & Seq
Reverse (-)
32511221 .. 32513657
2437 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG283600.1

Sequence Viewer

Length: 429 bp
ATGTCTATTGCTTTGGACAGAAATGGGAATAGTGGGAATGGTATGATCCCACGGTCCGGGAGGTTCATCCATGGGATGCCTTGTATTTCGATCTACGACACAAAAGGGTTTGATCAGGATCGTCGTTTAGAGTTGGAGGAGGACTCTAGTAGCTCGAGGTCCTCGTCGGTTGGTAATAACAGTGACCAGTCTAATGGTTCTAAGGTTGCCTTTTCCCAATCTATTCTCAACGTCCTTATTTCATCCTCTTTAGATGCTATGAGTATGACCAAGTTGAGGAAGCTAAATCGAACTATGGCTCATCGCTTGTCCATCCTGACGACACAGGTGTCGCAGTTGGTGAAGATCGAACGCATTGAAACCACGGTTGCCAAGATCGACCAGTTTGCACCTTCTAAACAAGATAAGAGAAAGCGCTCCGAGATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

142

Amino Acids

15.75

Weight (kDa)

9.83

Isoelectric Point (pI)

70.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 328
AclWI GGATC 2 cut(s) 40, 126
AfeI AGCGCT 1 cut(s) 416
AfiI CCNNNNNNNGG 2 cut(s) 56, 276
AgsI TTSAA 1 cut(s) 359
AluBI AGCT 2 cut(s) 153, 283
AluI AGCT 2 cut(s) 153, 283
AlwI GGATC 2 cut(s) 40, 126
Ama87I CYCGRG 1 cut(s) 154
Aor51HI AGCGCT 1 cut(s) 416
AspLEI GCGC 1 cut(s) 417
AspS9I GGNCC 2 cut(s) 54, 159
AsuC2I CCSGG 1 cut(s) 58
AsuHPI GGTGA 1 cut(s) 352
AvaI CYCGRG 1 cut(s) 154
AvaII GGWCC 2 cut(s) 54, 159
BccI CCATC 1 cut(s) 320
BcgI CGANNNNNNTGC 2 cut(s) 368, 402
BclI TGATCA 1 cut(s) 112
BcnI CCSGG 1 cut(s) 58
BfaI CTAG 1 cut(s) 147
BfoI RGCGCY 1 cut(s) 418
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 2 cut(s) 54, 159
BmeT110I CYCGRG 1 cut(s) 154
BmgT120I GGNCC 2 cut(s) 54, 159
BmrFI CCNGG 1 cut(s) 58
BmsI GCATC 2 cut(s) 66, 244
BplI GAGNNNNNCTC 2 cut(s) 128, 160
BpuMI CCSGG 1 cut(s) 58
BsaBI GATNNNNATC 1 cut(s) 117
BsaJI CCNNGG 3 cut(s) 50, 70, 363
Bsc4I CCNNNNNNNGG 2 cut(s) 56, 276
Bse1I ACTGG 2 cut(s) 187, 382
Bse8I GATNNNNATC 1 cut(s) 117
BseDI CCNNGG 3 cut(s) 50, 70, 363
BseGI GGATG 4 cut(s) 66, 81, 242, 312
BseJI GATNNNNATC 1 cut(s) 117
BseLI CCNNNNNNNGG 2 cut(s) 56, 276
BseNI ACTGG 2 cut(s) 187, 382
BseRI GAGGAG 1 cut(s) 152
BsiHKCI CYCGRG 1 cut(s) 154
BsiSI CCGG 1 cut(s) 57
BslI CCNNNNNNNGG 2 cut(s) 56, 276
BsoBI CYCGRG 1 cut(s) 154
Bsp143I GATC 6 cut(s) 45, 90, 112, 118, 345, 375
Bsp19I CCATGG 1 cut(s) 70
BspPI GGATC 2 cut(s) 40, 126
BsrI ACTGG 2 cut(s) 187, 382
BssECI CCNNGG 3 cut(s) 50, 70, 363
BssMI GATC 6 cut(s) 45, 90, 112, 118, 345, 375
BssT1I CCWWGG 1 cut(s) 70
Bst4CI ACNGT 3 cut(s) 54, 182, 367
BstDEI CTNAG 1 cut(s) 201
BstDSI CCRYGG 3 cut(s) 50, 70, 363
BstF5I GGATG 4 cut(s) 66, 81, 242, 312
BstH2I RGCGCY 1 cut(s) 418
BstHHI GCGC 1 cut(s) 417
BstKTI GATC 6 cut(s) 48, 93, 115, 121, 348, 378
BstMBI GATC 6 cut(s) 45, 90, 112, 118, 345, 375
BstSCI CCNGG 1 cut(s) 56
BstXI CCANNNNNNTGG 1 cut(s) 194
BtgI CCRYGG 3 cut(s) 50, 70, 363
BtgZI GCGATG 1 cut(s) 287
BtsCI GGATG 4 cut(s) 66, 81, 242, 312
BtsIMutI CAGTG 1 cut(s) 187
CfoI GCGC 1 cut(s) 417
Cfr13I GGNCC 2 cut(s) 54, 159
CpoI CGGWCCG 1 cut(s) 54
CspI CGGWCCG 1 cut(s) 54
CviAII CATG 1 cut(s) 71
CviJI RGCY 3 cut(s) 153, 283, 299
CviKI_1 RGCY 3 cut(s) 153, 283, 299
DdeI CTNAG 1 cut(s) 201
DpnI GATC 6 cut(s) 47, 92, 114, 120, 347, 377
DpnII GATC 6 cut(s) 45, 90, 112, 118, 345, 375
DrdI GACNNNNNNGTC 1 cut(s) 328
DseDI GACNNNNNNGTC 1 cut(s) 328
Eco130I CCWWGG 1 cut(s) 70
Eco47I GGWCC 2 cut(s) 54, 159
Eco47III AGCGCT 1 cut(s) 416
Eco88I CYCGRG 1 cut(s) 154
EcoO109I RGGNCCY 1 cut(s) 159
EcoT14I CCWWGG 1 cut(s) 70
ErhI CCWWGG 1 cut(s) 70
FaeI CATG 1 cut(s) 74
FaiI YATR 5 cut(s) 44, 72, 260, 266, 296
FalI AAGNNNNNCTT 2 cut(s) 194, 226
FatI CATG 1 cut(s) 70
FbaI TGATCA 1 cut(s) 112
FokI GGATG 4 cut(s) 53, 88, 229, 299
FspBI CTAG 1 cut(s) 147
GlaI GCGC 1 cut(s) 416
HaeII RGCGCY 1 cut(s) 418
HapII CCGG 1 cut(s) 57
HhaI GCGC 1 cut(s) 417
Hin1II CATG 1 cut(s) 74
Hin6I GCGC 1 cut(s) 415
HinP1I GCGC 1 cut(s) 415
HinfI GANTC 1 cut(s) 143
HpaII CCGG 1 cut(s) 57
HphI GGTGA 1 cut(s) 352
Hpy188I TCNGA 1 cut(s) 421
Hpy188III TCNNGA 2 cut(s) 116, 316
Hpy99I CGWCG 2 cut(s) 126, 169
HpyAV CCTTC 1 cut(s) 402
HpyCH4III ACNGT 3 cut(s) 54, 182, 367
HpyCH4IV ACGT 1 cut(s) 231
HpyCH4V TGCA 1 cut(s) 389
HpyF3I CTNAG 1 cut(s) 201
HpySE526I ACGT 1 cut(s) 231
Hsp92II CATG 1 cut(s) 74
HspAI GCGC 1 cut(s) 415
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 6 cut(s) 45, 90, 112, 118, 345, 375
LmnI GCTCC 1 cut(s) 422
LpnPI CCDG 6 cut(s) 70, 101, 200, 311, 329, 395
LweI GCATC 2 cut(s) 66, 244
MaeI CTAG 1 cut(s) 147
MaeII ACGT 1 cut(s) 231
MaeIII GTNAC 1 cut(s) 182
MalI GATC 6 cut(s) 47, 92, 114, 120, 347, 377
MboI GATC 6 cut(s) 45, 90, 112, 118, 345, 375
MboII GAAGA 1 cut(s) 355
MlyI GAGTC 1 cut(s) 137
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 7 cut(s) 54, 130, 133, 150, 172, 256, 270
MspI CCGG 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 58
NciI CCSGG 1 cut(s) 58
NcoI CCATGG 1 cut(s) 70
NdeII GATC 6 cut(s) 45, 90, 112, 118, 345, 375
NlaIII CATG 1 cut(s) 74
NmuCI GTSAC 1 cut(s) 182
PaeR7I CTCGAG 1 cut(s) 154
PcsI WCGNNNNNNNCGW 1 cut(s) 161
PfoI TCCNGGA 1 cut(s) 56
PleI GAGTC 1 cut(s) 137
PpsI GAGTC 1 cut(s) 137
PpuMI RGGWCCY 1 cut(s) 159
Psp5II RGGWCCY 1 cut(s) 159
PspPI GGNCC 2 cut(s) 54, 159
PspPPI RGGWCCY 1 cut(s) 159
PspXI VCTCGAGB 1 cut(s) 154
Rsr2I CGGWCCG 1 cut(s) 54
RsrII CGGWCCG 1 cut(s) 54
Sau3AI GATC 6 cut(s) 45, 90, 112, 118, 345, 375
Sau96I GGNCC 2 cut(s) 54, 159
SchI GAGTC 1 cut(s) 137
ScrFI CCNGG 1 cut(s) 58
SetI ASST 8 cut(s) 65, 155, 161, 207, 234, 285, 330, 394
SfaNI GCATC 2 cut(s) 66, 244
Sfr274I CTCGAG 1 cut(s) 154
SinI GGWCC 2 cut(s) 54, 159
SlaI CTCGAG 1 cut(s) 154
SmlI CTYRAG 1 cut(s) 154
SmoI CTYRAG 1 cut(s) 154
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 56
StyI CCWWGG 1 cut(s) 70
TaaI ACNGT 3 cut(s) 54, 182, 367
TaiI ACGT 1 cut(s) 234
TaqI TCGA 5 cut(s) 89, 155, 289, 348, 378
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 2 cut(s) 55, 231
TspRI CASTG 1 cut(s) 187
VpaK11BI GGWCC 2 cut(s) 54, 159
XhoI CTCGAG 1 cut(s) 154
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.