Rh4AG147800

RNA binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0000728
Physical Location & Seq
Forward (+)
37398654 .. 37399984
1331 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG147800.1

Sequence Viewer

Length: 303 bp
ATGTCTATTGCTTTGGACAGAAATGGGAATAGTGGGAATGGTATGATCCCACGGTCCGGGAGATTCATCCATGGGATGCCTTGTATTTTGATCTACGACACAAAAGGGTTTGATCAGGATCGTCGTTTGGAGTTGGAGGAGGACTCTAGTAGCTCGAGGTCCTCGTCGGTTGGTAATAACAGTGACGAGTCTAATGGGTCGTCGGAGGGTGAGGTTCAAAGCTCGTTTAAATGGCCTTTGGACACCATGGACCAGCTTGAGGAGGTTTTGCCTGTCAATAATATCAGATGTGGTCTTATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.0

Weight (kDa)

4.49

Isoelectric Point (pI)

67.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 40, 126
AfiI CCNNNNNNNGG 2 cut(s) 56, 259
AgsI TTSAA 1 cut(s) 218
AluBI AGCT 3 cut(s) 153, 222, 256
AluI AGCT 3 cut(s) 153, 222, 256
AlwI GGATC 2 cut(s) 40, 126
Ama87I CYCGRG 1 cut(s) 154
AoxI GGCC 1 cut(s) 233
AspS9I GGNCC 3 cut(s) 54, 159, 250
AsuC2I CCSGG 1 cut(s) 58
AsuHPI GGTGA 1 cut(s) 221
AvaI CYCGRG 1 cut(s) 154
AvaII GGWCC 3 cut(s) 54, 159, 250
BclI TGATCA 1 cut(s) 112
BcnI CCSGG 1 cut(s) 58
BfaI CTAG 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 58
Bme18I GGWCC 3 cut(s) 54, 159, 250
BmeT110I CYCGRG 1 cut(s) 154
BmgT120I GGNCC 3 cut(s) 54, 159, 250
BmrFI CCNGG 1 cut(s) 58
BmsI GCATC 1 cut(s) 66
BplI GAGNNNNNCTC 2 cut(s) 128, 160
BpuEI CTTGAG 1 cut(s) 278
BpuMI CCSGG 1 cut(s) 58
BsaBI GATNNNNATC 1 cut(s) 117
BsaJI CCNNGG 3 cut(s) 50, 70, 246
Bsc4I CCNNNNNNNGG 2 cut(s) 56, 259
Bse8I GATNNNNATC 1 cut(s) 117
BseDI CCNNGG 3 cut(s) 50, 70, 246
BseGI GGATG 2 cut(s) 66, 81
BseJI GATNNNNATC 1 cut(s) 117
BseLI CCNNNNNNNGG 2 cut(s) 56, 259
BseRI GAGGAG 2 cut(s) 152, 275
BshFI GGCC 1 cut(s) 235
BsiHKCI CYCGRG 1 cut(s) 154
BsiSI CCGG 1 cut(s) 57
BslI CCNNNNNNNGG 2 cut(s) 56, 259
BsnI GGCC 1 cut(s) 235
BsoBI CYCGRG 1 cut(s) 154
Bsp143I GATC 4 cut(s) 45, 90, 112, 118
Bsp19I CCATGG 2 cut(s) 70, 246
BspANI GGCC 1 cut(s) 235
BspPI GGATC 2 cut(s) 40, 126
BssECI CCNNGG 3 cut(s) 50, 70, 246
BssMI GATC 4 cut(s) 45, 90, 112, 118
BssT1I CCWWGG 2 cut(s) 70, 246
Bst4CI ACNGT 2 cut(s) 54, 182
BstDSI CCRYGG 3 cut(s) 50, 70, 246
BstF5I GGATG 2 cut(s) 66, 81
BstKTI GATC 4 cut(s) 48, 93, 115, 121
BstMBI GATC 4 cut(s) 45, 90, 112, 118
BstSCI CCNGG 1 cut(s) 56
BsuRI GGCC 1 cut(s) 235
BtgI CCRYGG 3 cut(s) 50, 70, 246
BtsCI GGATG 2 cut(s) 66, 81
BtsIMutI CAGTG 1 cut(s) 187
Cfr13I GGNCC 3 cut(s) 54, 159, 250
CpoI CGGWCCG 1 cut(s) 54
CspI CGGWCCG 1 cut(s) 54
CviAII CATG 2 cut(s) 71, 247
CviJI RGCY 4 cut(s) 153, 222, 235, 256
CviKI_1 RGCY 4 cut(s) 153, 222, 235, 256
DpnI GATC 4 cut(s) 47, 92, 114, 120
DpnII GATC 4 cut(s) 45, 90, 112, 118
DraI TTTAAA 1 cut(s) 229
Eco130I CCWWGG 2 cut(s) 70, 246
Eco47I GGWCC 3 cut(s) 54, 159, 250
Eco88I CYCGRG 1 cut(s) 154
EcoO109I RGGNCCY 1 cut(s) 159
EcoT14I CCWWGG 2 cut(s) 70, 246
ErhI CCWWGG 2 cut(s) 70, 246
FaeI CATG 2 cut(s) 74, 250
FaiI YATR 3 cut(s) 44, 72, 248
FatI CATG 2 cut(s) 70, 246
FbaI TGATCA 1 cut(s) 112
FokI GGATG 2 cut(s) 53, 88
FspBI CTAG 1 cut(s) 147
HaeIII GGCC 1 cut(s) 235
HapII CCGG 1 cut(s) 57
Hin1II CATG 2 cut(s) 74, 250
HinfI GANTC 3 cut(s) 63, 143, 188
HpaII CCGG 1 cut(s) 57
HphI GGTGA 1 cut(s) 221
Hpy188I TCNGA 2 cut(s) 205, 287
Hpy188III TCNNGA 1 cut(s) 116
Hpy99I CGWCG 3 cut(s) 126, 169, 205
HpyCH4III ACNGT 2 cut(s) 54, 182
Hsp92II CATG 2 cut(s) 74, 250
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 4 cut(s) 45, 90, 112, 118
LpnPI CCDG 4 cut(s) 70, 101, 266, 285
LweI GCATC 1 cut(s) 66
MaeI CTAG 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 182
MalI GATC 4 cut(s) 47, 92, 114, 120
MboI GATC 4 cut(s) 45, 90, 112, 118
MlyI GAGTC 2 cut(s) 137, 197
MmeI TCCRAC 2 cut(s) 114, 183
MnlI CCTC 8 cut(s) 130, 133, 150, 172, 199, 205, 253, 256
MseI TTAA 1 cut(s) 228
MspI CCGG 1 cut(s) 57
MspR9I CCNGG 1 cut(s) 58
NciI CCSGG 1 cut(s) 58
NcoI CCATGG 2 cut(s) 70, 246
NdeII GATC 4 cut(s) 45, 90, 112, 118
NlaIII CATG 2 cut(s) 74, 250
NmuCI GTSAC 1 cut(s) 182
PaeR7I CTCGAG 1 cut(s) 154
PcsI WCGNNNNNNNCGW 1 cut(s) 161
PfeI GAWTC 1 cut(s) 63
PfoI TCCNGGA 1 cut(s) 56
PleI GAGTC 2 cut(s) 137, 196
PpsI GAGTC 2 cut(s) 137, 196
PpuMI RGGWCCY 1 cut(s) 159
Psp5II RGGWCCY 1 cut(s) 159
PspPI GGNCC 3 cut(s) 54, 159, 250
PspPPI RGGWCCY 1 cut(s) 159
PspXI VCTCGAGB 1 cut(s) 154
Rsr2I CGGWCCG 1 cut(s) 54
RsrII CGGWCCG 1 cut(s) 54
SaqAI TTAA 1 cut(s) 228
Sau3AI GATC 4 cut(s) 45, 90, 112, 118
Sau96I GGNCC 3 cut(s) 54, 159, 250
SchI GAGTC 2 cut(s) 137, 197
ScrFI CCNGG 1 cut(s) 58
SetI ASST 6 cut(s) 155, 161, 216, 224, 258, 267
SfaNI GCATC 1 cut(s) 66
Sfr274I CTCGAG 1 cut(s) 154
SinI GGWCC 3 cut(s) 54, 159, 250
SlaI CTCGAG 1 cut(s) 154
SmlI CTYRAG 2 cut(s) 154, 257
SmoI CTYRAG 2 cut(s) 154, 257
SspMI CTAG 1 cut(s) 147
StyD4I CCNGG 1 cut(s) 56
StyI CCWWGG 2 cut(s) 70, 246
TaaI ACNGT 2 cut(s) 54, 182
TaqI TCGA 1 cut(s) 155
TfiI GAWTC 1 cut(s) 63
Tru1I TTAA 1 cut(s) 228
Tru9I TTAA 1 cut(s) 228
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 1 cut(s) 55
TspRI CASTG 1 cut(s) 187
VpaK11BI GGWCC 3 cut(s) 54, 159, 250
XhoI CTCGAG 1 cut(s) 154
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.