Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004359.1

Orthogroup ID

OG0000728

Physical Location & Seq

Genomic Coordinates Forward (+)

109024 .. 110002

Gene Structure 979 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004359.1_g000032.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 387 bp

atgtctattgctttggacagaaatgggaatagtgggaatggtatgatcccacggtccgggaggttcatccatgggatgccttgtatttcgatctacgacacaaaagggtttgatcaggatcgtcgtttggagttggaggaggactctagtagctcgaggtcctcgtcggttggtaataacagtgacgagtctaatggtttgtgtgcttgtatgtgtcagagtatgaccaagttgaggaagctaaaccgaactatggctcattgcctgtccatgctgacgacacaggtgtcgcagttggtgaagatcgaacgcattgaaaccacgattgccaagatcgaccagtttgcaccttctaagcaagataagagaaagcgctccgagatttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

128

Amino Acids

14.29

Weight (kDa)

8.93

Isoelectric Point (pI)

71.93

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000728)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G43850 AT3G43850 AT5G21940
fragaria_vesca	FvH4_1g08640 FvH4_2g30890
malus_domestica	MD02G1091300.v1.1 MD08G1072700.v1.1 MD15G1049100.v1.1 MD15G1217500.v1.1
prunus_persica	Prupe.1G403400_v2.0.a1 Prupe.7G199000_v2.0.a1
pyrus_communis	pycom02g07280 pycom08g06000 pycom15g04790 pycom15g19310
rosa_chinensis	RchiOBHm_Chr1g0322321 RchiOBHm_Chr1g0336271 RchiOBHm_Chr2g0094921 RchiOBHm_Chr3g0491201 RchiOBHm_Chr4g0419681 RchiOBHm_Chr6g0269001 RchiOBHm_Chr6g0311951
rosa_laevigata	RLG00000001977 RLG00000010366 RLG00000010816 RLG00000016531 RLG00000016764
rosa_multiflora	Rmu_sc0000726.1_g000004 Rmu_sc0001772.1_g000023 Rmu_sc0001910.1_g000001 Rmu_sc0002270.1_g000009 Rmu_sc0004316.1_g000003 Rmu_sc0004359.1_g000032 Rmu_sc0004406.1_g000018 Rmu_sc0005381.1_g000003 Rmu_sc0006611.1_g000001
rosa_roxburghii	Rroxscaffold_1G00046160 Rroxscaffold_2G00146770 Rroxscaffold_7G00157190
rosa_rugosa	Rorug02G0048900 Rorug04G0408100.1 Rorug05G0539300 Rorug06G0303900 Rorug06G0304000 Rorug06G0391600
rosa_samantha	Rh1AG424000 Rh2AG095500 Rh2AG334700 Rh2BG096500 Rh2BG097300 Rh2BG097400 Rh2CG098500 Rh2CG099400 Rh2DG095200 Rh2DG096800 Rh2DG283600 Rh3AG144800 Rh3AG297300 Rh3BG167200 Rh4AG147800 Rh6AG508100 Rh6BG519300 Rh6CG525000 Rh6DG172200 Rh6DG510600 Rh7AG234100 Rh7DG193900 Rh7DG241800 Rh7DG390800
rosa_wichuraiana	Rw1G018420 Rw2G007190 Rw6G044230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	286
AclWI	GGATC	2 cut(s)	40, 126
AfeI	AGCGCT	1 cut(s)	374
AfiI	CCNNNNNNNGG	3 cut(s)	56, 234, 253
AgsI	TTSAA	1 cut(s)	317
AluBI	AGCT	2 cut(s)	153, 241
AluI	AGCT	2 cut(s)	153, 241
AlwI	GGATC	2 cut(s)	40, 126
Ama87I	CYCGRG	1 cut(s)	154
Aor51HI	AGCGCT	1 cut(s)	374
AspLEI	GCGC	1 cut(s)	375
AspS9I	GGNCC	2 cut(s)	54, 159
AsuC2I	CCSGG	1 cut(s)	58
AsuHPI	GGTGA	1 cut(s)	310
AvaI	CYCGRG	1 cut(s)	154
AvaII	GGWCC	2 cut(s)	54, 159
BcgI	CGANNNNNNTGC	2 cut(s)	326, 360
BclI	TGATCA	1 cut(s)	112
BcnI	CCSGG	1 cut(s)	58
BfaI	CTAG	1 cut(s)	147
BfoI	RGCGCY	1 cut(s)	376
Bme1390I	CCNGG	1 cut(s)	58
Bme18I	GGWCC	2 cut(s)	54, 159
BmeT110I	CYCGRG	1 cut(s)	154
BmgT120I	GGNCC	2 cut(s)	54, 159
BmrFI	CCNGG	1 cut(s)	58
BmsI	GCATC	1 cut(s)	66
BplI	GAGNNNNNCTC	2 cut(s)	128, 160
BpuMI	CCSGG	1 cut(s)	58
BsaBI	GATNNNNATC	1 cut(s)	117
BsaJI	CCNNGG	2 cut(s)	50, 70
Bsc4I	CCNNNNNNNGG	3 cut(s)	56, 234, 253
Bse1I	ACTGG	1 cut(s)	340
Bse3DI	GCAATG	1 cut(s)	259
Bse8I	GATNNNNATC	1 cut(s)	117
BseDI	CCNNGG	2 cut(s)	50, 70
BseGI	GGATG	2 cut(s)	66, 81
BseJI	GATNNNNATC	1 cut(s)	117
BseLI	CCNNNNNNNGG	3 cut(s)	56, 234, 253
BseMI	GCAATG	1 cut(s)	259
BseNI	ACTGG	1 cut(s)	340
BseRI	GAGGAG	1 cut(s)	152
BsiHKCI	CYCGRG	1 cut(s)	154
BsiSI	CCGG	1 cut(s)	57
BslI	CCNNNNNNNGG	3 cut(s)	56, 234, 253
BsoBI	CYCGRG	1 cut(s)	154
Bsp143I	GATC	6 cut(s)	45, 90, 112, 118, 303, 333
Bsp19I	CCATGG	1 cut(s)	70
BspPI	GGATC	2 cut(s)	40, 126
BsrDI	GCAATG	1 cut(s)	259
BsrI	ACTGG	1 cut(s)	340
BssECI	CCNNGG	2 cut(s)	50, 70
BssMI	GATC	6 cut(s)	45, 90, 112, 118, 303, 333
BssT1I	CCWWGG	1 cut(s)	70
Bst4CI	ACNGT	2 cut(s)	54, 182
BstDEI	CTNAG	1 cut(s)	354
BstDSI	CCRYGG	2 cut(s)	50, 70
BstF5I	GGATG	2 cut(s)	66, 81
BstH2I	RGCGCY	1 cut(s)	376
BstHHI	GCGC	1 cut(s)	375
BstKTI	GATC	6 cut(s)	48, 93, 115, 121, 306, 336
BstMBI	GATC	6 cut(s)	45, 90, 112, 118, 303, 333
BstSCI	CCNGG	1 cut(s)	56
BtgI	CCRYGG	2 cut(s)	50, 70
BtsCI	GGATG	2 cut(s)	66, 81
BtsIMutI	CAGTG	1 cut(s)	187
CfoI	GCGC	1 cut(s)	375
Cfr13I	GGNCC	2 cut(s)	54, 159
CpoI	CGGWCCG	1 cut(s)	54
CspI	CGGWCCG	1 cut(s)	54
CviAII	CATG	2 cut(s)	71, 271
CviJI	RGCY	3 cut(s)	153, 241, 257
CviKI_1	RGCY	3 cut(s)	153, 241, 257
DdeI	CTNAG	1 cut(s)	354
DpnI	GATC	6 cut(s)	47, 92, 114, 120, 305, 335
DpnII	GATC	6 cut(s)	45, 90, 112, 118, 303, 333
DrdI	GACNNNNNNGTC	1 cut(s)	286
DseDI	GACNNNNNNGTC	1 cut(s)	286
Eco130I	CCWWGG	1 cut(s)	70
Eco47I	GGWCC	2 cut(s)	54, 159
Eco47III	AGCGCT	1 cut(s)	374
Eco88I	CYCGRG	1 cut(s)	154
EcoO109I	RGGNCCY	1 cut(s)	159
EcoT14I	CCWWGG	1 cut(s)	70
ErhI	CCWWGG	1 cut(s)	70
FaeI	CATG	2 cut(s)	74, 274
FaiI	YATR	6 cut(s)	44, 72, 212, 224, 254, 272
FatI	CATG	2 cut(s)	70, 270
FbaI	TGATCA	1 cut(s)	112
FokI	GGATG	2 cut(s)	53, 88
FspBI	CTAG	1 cut(s)	147
GlaI	GCGC	1 cut(s)	374
HaeII	RGCGCY	1 cut(s)	376
HapII	CCGG	1 cut(s)	57
HhaI	GCGC	1 cut(s)	375
Hin1II	CATG	2 cut(s)	74, 274
Hin6I	GCGC	1 cut(s)	373
HinP1I	GCGC	1 cut(s)	373
HinfI	GANTC	2 cut(s)	143, 188
HpaII	CCGG	1 cut(s)	57
HphI	GGTGA	1 cut(s)	310
Hpy188I	TCNGA	2 cut(s)	219, 379
Hpy188III	TCNNGA	1 cut(s)	116
Hpy99I	CGWCG	2 cut(s)	126, 169
HpyAV	CCTTC	1 cut(s)	360
HpyCH4III	ACNGT	2 cut(s)	54, 182
HpyCH4V	TGCA	1 cut(s)	347
HpyF3I	CTNAG	1 cut(s)	354
Hsp92II	CATG	2 cut(s)	74, 274
HspAI	GCGC	1 cut(s)	373
Ksp22I	TGATCA	1 cut(s)	112
Kzo9I	GATC	6 cut(s)	45, 90, 112, 118, 303, 333
LmnI	GCTCC	1 cut(s)	380
LpnPI	CCDG	5 cut(s)	70, 101, 269, 278, 353
LweI	GCATC	1 cut(s)	66
MaeI	CTAG	1 cut(s)	147
MaeIII	GTNAC	1 cut(s)	182
MalI	GATC	6 cut(s)	47, 92, 114, 120, 305, 335
MboI	GATC	6 cut(s)	45, 90, 112, 118, 303, 333
MboII	GAAGA	1 cut(s)	313
MlyI	GAGTC	2 cut(s)	137, 197
MmeI	TCCRAC	1 cut(s)	114
MnlI	CCTC	6 cut(s)	54, 130, 133, 150, 172, 228
MspI	CCGG	1 cut(s)	57
MspR9I	CCNGG	1 cut(s)	58
NciI	CCSGG	1 cut(s)	58
NcoI	CCATGG	1 cut(s)	70
NdeII	GATC	6 cut(s)	45, 90, 112, 118, 303, 333
NlaIII	CATG	2 cut(s)	74, 274
NmuCI	GTSAC	1 cut(s)	182
PaeR7I	CTCGAG	1 cut(s)	154
PcsI	WCGNNNNNNNCGW	1 cut(s)	161
PfoI	TCCNGGA	1 cut(s)	56
PleI	GAGTC	2 cut(s)	137, 196
PpsI	GAGTC	2 cut(s)	137, 196
PpuMI	RGGWCCY	1 cut(s)	159
Psp5II	RGGWCCY	1 cut(s)	159
PspPI	GGNCC	2 cut(s)	54, 159
PspPPI	RGGWCCY	1 cut(s)	159
PspXI	VCTCGAGB	1 cut(s)	154
Rsr2I	CGGWCCG	1 cut(s)	54
RsrII	CGGWCCG	1 cut(s)	54
Sau3AI	GATC	6 cut(s)	45, 90, 112, 118, 303, 333
Sau96I	GGNCC	2 cut(s)	54, 159
SchI	GAGTC	2 cut(s)	137, 197
ScrFI	CCNGG	1 cut(s)	58
SetI	ASST	6 cut(s)	65, 155, 161, 243, 288, 352
SfaNI	GCATC	1 cut(s)	66
Sfr274I	CTCGAG	1 cut(s)	154
SinI	GGWCC	2 cut(s)	54, 159
SlaI	CTCGAG	1 cut(s)	154
SmlI	CTYRAG	1 cut(s)	154
SmoI	CTYRAG	1 cut(s)	154
SspMI	CTAG	1 cut(s)	147
StyD4I	CCNGG	1 cut(s)	56
StyI	CCWWGG	1 cut(s)	70
TaaI	ACNGT	2 cut(s)	54, 182
TaqI	TCGA	4 cut(s)	89, 155, 306, 336
TscAI	CASTG	1 cut(s)	187
TseFI	GTSAC	1 cut(s)	182
Tsp45I	GTSAC	1 cut(s)	182
TspDTI	ATGAA	1 cut(s)	55
TspRI	CASTG	1 cut(s)	187
VpaK11BI	GGWCC	2 cut(s)	54, 159
XhoI	CTCGAG	1 cut(s)	154
XspI	CTAG	1 cut(s)	147

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.