Rw1G018420

RNA binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0000728
Physical Location & Seq
Forward (+)
40587599 .. 40589481
1883 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G018420.1

Sequence Viewer

Length: 360 bp
ATGTCTATTGCTTTGGACAGAAATGGGAATAGTGGGAATGGTATGATCCCACGGTTCGGGAGGTTCATCCATAGGATGCCTTGTATTTCGATCTATGACACAAAAGGGTTTGATCAGGATCGTCGTTTGGAGTTGGAGGAGGACTCTAGTAGCTCGAGGTCGTCGTCGGTTGGTAATAATAGTGACGAGTCTAATGGGTCATCGGAGGGTGAGGTTCAGAGCTCGTTTAAAGGGCATTTGGACACCATGGACCAGCTTGAGGAGGTTTTGCCTGTCAAACAGAGAGAGACTGAAAGGAAAACAGGAGTGATCGATCTGGAGTTGTTTGACAAGAGGTGTAGAGATAGAGAGAAACTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

119

Amino Acids

13.5

Weight (kDa)

5.08

Isoelectric Point (pI)

53.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 40, 126
AfiI CCNNNNNNNGG 2 cut(s) 56, 259
AluBI AGCT 3 cut(s) 153, 222, 256
AluI AGCT 3 cut(s) 153, 222, 256
Alw21I GWGCWC 1 cut(s) 224
Alw26I GTCTC 1 cut(s) 281
AlwI GGATC 2 cut(s) 40, 126
Ama87I CYCGRG 1 cut(s) 154
AspS9I GGNCC 1 cut(s) 250
AsuHPI GGTGA 1 cut(s) 221
AvaI CYCGRG 1 cut(s) 154
AvaII GGWCC 1 cut(s) 250
BanII GRGCYC 1 cut(s) 224
Bbv12I GWGCWC 1 cut(s) 224
BclI TGATCA 1 cut(s) 112
BcoDI GTCTC 1 cut(s) 281
BfaI CTAG 1 cut(s) 147
Bme18I GGWCC 1 cut(s) 250
BmeT110I CYCGRG 1 cut(s) 154
BmgT120I GGNCC 1 cut(s) 250
BmsI GCATC 1 cut(s) 66
BplI GAGNNNNNCTC 2 cut(s) 128, 160
BpmI CTGGAG 1 cut(s) 338
BpuEI CTTGAG 1 cut(s) 278
Bsa29I ATCGAT 1 cut(s) 312
BsaBI GATNNNNATC 1 cut(s) 117
BsaJI CCNNGG 2 cut(s) 50, 246
Bsc4I CCNNNNNNNGG 2 cut(s) 56, 259
Bse8I GATNNNNATC 1 cut(s) 117
BseCI ATCGAT 1 cut(s) 312
BseDI CCNNGG 2 cut(s) 50, 246
BseGI GGATG 2 cut(s) 66, 81
BseJI GATNNNNATC 1 cut(s) 117
BseLI CCNNNNNNNGG 2 cut(s) 56, 259
BseRI GAGGAG 2 cut(s) 152, 275
BshVI ATCGAT 1 cut(s) 312
BsiHKAI GWGCWC 1 cut(s) 224
BsiHKCI CYCGRG 1 cut(s) 154
BslI CCNNNNNNNGG 2 cut(s) 56, 259
BsmAI GTCTC 1 cut(s) 281
BsoBI CYCGRG 1 cut(s) 154
Bsp1286I GDGCHC 1 cut(s) 224
Bsp143I GATC 6 cut(s) 45, 90, 112, 118, 309, 313
Bsp19I CCATGG 1 cut(s) 246
BspDI ATCGAT 1 cut(s) 312
BspPI GGATC 2 cut(s) 40, 126
BssECI CCNNGG 2 cut(s) 50, 246
BssMI GATC 6 cut(s) 45, 90, 112, 118, 309, 313
BssT1I CCWWGG 1 cut(s) 246
Bst4CI ACNGT 2 cut(s) 54, 357
BstDSI CCRYGG 2 cut(s) 50, 246
BstF5I GGATG 2 cut(s) 66, 81
BstKTI GATC 6 cut(s) 48, 93, 115, 121, 312, 316
BstMAI GTCTC 1 cut(s) 281
BstMBI GATC 6 cut(s) 45, 90, 112, 118, 309, 313
Bsu15I ATCGAT 1 cut(s) 312
BsuTUI ATCGAT 1 cut(s) 312
BtgI CCRYGG 2 cut(s) 50, 246
BtsCI GGATG 2 cut(s) 66, 81
Cfr13I GGNCC 1 cut(s) 250
ClaI ATCGAT 1 cut(s) 312
CviAII CATG 1 cut(s) 247
CviJI RGCY 3 cut(s) 153, 222, 256
CviKI_1 RGCY 3 cut(s) 153, 222, 256
DpnI GATC 6 cut(s) 47, 92, 114, 120, 311, 315
DpnII GATC 6 cut(s) 45, 90, 112, 118, 309, 313
DraI TTTAAA 1 cut(s) 229
Ecl136II GAGCTC 1 cut(s) 222
Eco130I CCWWGG 1 cut(s) 246
Eco24I GRGCYC 1 cut(s) 224
Eco47I GGWCC 1 cut(s) 250
Eco53kI GAGCTC 1 cut(s) 222
Eco88I CYCGRG 1 cut(s) 154
EcoICRI GAGCTC 1 cut(s) 222
EcoT14I CCWWGG 1 cut(s) 246
EcoT38I GRGCYC 1 cut(s) 224
ErhI CCWWGG 1 cut(s) 246
FaeI CATG 1 cut(s) 250
FaiI YATR 4 cut(s) 44, 72, 96, 248
FatI CATG 1 cut(s) 246
FbaI TGATCA 1 cut(s) 112
FokI GGATG 2 cut(s) 53, 88
FriOI GRGCYC 1 cut(s) 224
FspBI CTAG 1 cut(s) 147
GsuI CTGGAG 1 cut(s) 338
Hin1II CATG 1 cut(s) 250
HinfI GANTC 2 cut(s) 143, 188
HphI GGTGA 1 cut(s) 221
Hpy188I TCNGA 2 cut(s) 205, 219
Hpy188III TCNNGA 3 cut(s) 58, 116, 317
Hpy99I CGWCG 3 cut(s) 126, 166, 169
HpyCH4III ACNGT 2 cut(s) 54, 357
Hsp92II CATG 1 cut(s) 250
Ksp22I TGATCA 1 cut(s) 112
Kzo9I GATC 6 cut(s) 45, 90, 112, 118, 309, 313
LpnPI CCDG 5 cut(s) 101, 266, 285, 288, 302
LweI GCATC 1 cut(s) 66
MaeI CTAG 1 cut(s) 147
MaeIII GTNAC 1 cut(s) 182
MalI GATC 6 cut(s) 47, 92, 114, 120, 311, 315
MboI GATC 6 cut(s) 45, 90, 112, 118, 309, 313
MhlI GDGCHC 1 cut(s) 224
MlyI GAGTC 2 cut(s) 137, 197
MmeI TCCRAC 1 cut(s) 114
MnlI CCTC 9 cut(s) 54, 130, 133, 150, 199, 205, 253, 256, 327
MseI TTAA 1 cut(s) 228
NcoI CCATGG 1 cut(s) 246
NdeII GATC 6 cut(s) 45, 90, 112, 118, 309, 313
NlaIII CATG 1 cut(s) 250
NmuCI GTSAC 1 cut(s) 182
PaeR7I CTCGAG 1 cut(s) 154
PcsI WCGNNNNNNNCGW 1 cut(s) 161
PleI GAGTC 2 cut(s) 137, 196
PpsI GAGTC 2 cut(s) 137, 196
Psp124BI GAGCTC 1 cut(s) 224
PspPI GGNCC 1 cut(s) 250
PspXI VCTCGAGB 1 cut(s) 154
SacI GAGCTC 1 cut(s) 224
SaqAI TTAA 1 cut(s) 228
Sau3AI GATC 6 cut(s) 45, 90, 112, 118, 309, 313
Sau96I GGNCC 1 cut(s) 250
SchI GAGTC 2 cut(s) 137, 197
SduI GDGCHC 1 cut(s) 224
SetI ASST 8 cut(s) 65, 155, 161, 216, 224, 258, 267, 338
SfaNI GCATC 1 cut(s) 66
Sfr274I CTCGAG 1 cut(s) 154
SinI GGWCC 1 cut(s) 250
SlaI CTCGAG 1 cut(s) 154
SmlI CTYRAG 2 cut(s) 154, 257
SmoI CTYRAG 2 cut(s) 154, 257
SspMI CTAG 1 cut(s) 147
SstI GAGCTC 1 cut(s) 224
StyI CCWWGG 1 cut(s) 246
TaaI ACNGT 2 cut(s) 54, 357
TaqI TCGA 3 cut(s) 89, 155, 312
Tru1I TTAA 1 cut(s) 228
Tru9I TTAA 1 cut(s) 228
TseFI GTSAC 1 cut(s) 182
Tsp45I GTSAC 1 cut(s) 182
TspDTI ATGAA 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 250
XhoI CTCGAG 1 cut(s) 154
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.