Rmu_sc0004406.1_g000018

Belongs to the bacterial ribosomal protein bL17 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004406.1
Physical Location & Seq
Reverse (-)
79368 .. 79814
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004406.1_g000018.1.cds

Sequence Viewer

Length: 243 bp
atgtctcagagtatcaccaagttgaggaagctaaaccgaactatggctcatcgcctgtccatgctgacgacacagagtatcaccaagttgaggaagctaaaccgaactatggctcatcgcctgtccatgctgacgacacaggtttcgcagttggtgaagatcgaacgcattgaaaccacggttgccaagatcgaccagtttgcaccttctaaacaagacaagagcaagcgctccgagatttga

Protein Analysis

80

Amino Acids

9.28

Weight (kDa)

11.59

Isoelectric Point (pI)

60.93

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfeI AGCGCT 1 cut(s) 230
AfiI CCNNNNNNNGG 4 cut(s) 24, 43, 90, 109
AgsI TTSAA 1 cut(s) 173
AluBI AGCT 2 cut(s) 31, 97
AluI AGCT 2 cut(s) 31, 97
Alw26I GTCTC 1 cut(s) 9
Aor51HI AGCGCT 1 cut(s) 230
ArsI GACNNNNNNTTYG 2 cut(s) 127, 159
AspLEI GCGC 1 cut(s) 231
AsuHPI GGTGA 3 cut(s) 7, 73, 166
BcgI CGANNNNNNTGC 2 cut(s) 182, 216
BcoDI GTCTC 1 cut(s) 9
BfoI RGCGCY 1 cut(s) 232
BsaJI CCNNGG 1 cut(s) 177
Bsc4I CCNNNNNNNGG 4 cut(s) 24, 43, 90, 109
Bse1I ACTGG 1 cut(s) 196
BseDI CCNNGG 1 cut(s) 177
BseLI CCNNNNNNNGG 4 cut(s) 24, 43, 90, 109
BseMII CTCAG 1 cut(s) 20
BseNI ACTGG 1 cut(s) 196
BslI CCNNNNNNNGG 4 cut(s) 24, 43, 90, 109
BsmAI GTCTC 1 cut(s) 9
Bsp143I GATC 2 cut(s) 159, 189
BspCNI CTCAG 1 cut(s) 19
BsrI ACTGG 1 cut(s) 196
BssECI CCNNGG 1 cut(s) 177
BssMI GATC 2 cut(s) 159, 189
Bst4CI ACNGT 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 227
BstDEI CTNAG 1 cut(s) 6
BstDSI CCRYGG 1 cut(s) 177
BstH2I RGCGCY 1 cut(s) 232
BstHHI GCGC 1 cut(s) 231
BstKTI GATC 2 cut(s) 162, 192
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 2 cut(s) 159, 189
BtgI CCRYGG 1 cut(s) 177
BtgZI GCGATG 2 cut(s) 35, 101
Cac8I GCNNGC 1 cut(s) 227
CfoI GCGC 1 cut(s) 231
CviAII CATG 2 cut(s) 61, 127
CviJI RGCY 4 cut(s) 31, 47, 97, 113
CviKI_1 RGCY 4 cut(s) 31, 47, 97, 113
DdeI CTNAG 1 cut(s) 6
DpnI GATC 2 cut(s) 161, 191
DpnII GATC 2 cut(s) 159, 189
Eco47III AGCGCT 1 cut(s) 230
FaeI CATG 2 cut(s) 64, 130
FaiI YATR 4 cut(s) 44, 62, 110, 128
FatI CATG 2 cut(s) 60, 126
GlaI GCGC 1 cut(s) 230
HaeII RGCGCY 1 cut(s) 232
HhaI GCGC 1 cut(s) 231
Hin1II CATG 2 cut(s) 64, 130
Hin6I GCGC 1 cut(s) 229
HinP1I GCGC 1 cut(s) 229
HphI GGTGA 3 cut(s) 7, 73, 166
Hpy188I TCNGA 2 cut(s) 9, 235
HpyAV CCTTC 1 cut(s) 216
HpyCH4III ACNGT 1 cut(s) 181
HpyCH4V TGCA 1 cut(s) 203
HpyF3I CTNAG 1 cut(s) 6
Hsp92II CATG 2 cut(s) 64, 130
HspAI GCGC 1 cut(s) 229
Kzo9I GATC 2 cut(s) 159, 189
LmnI GCTCC 1 cut(s) 236
LpnPI CCDG 4 cut(s) 68, 125, 134, 209
MalI GATC 2 cut(s) 161, 191
MboI GATC 2 cut(s) 159, 189
MboII GAAGA 1 cut(s) 169
MnlI CCTC 2 cut(s) 18, 84
NdeII GATC 2 cut(s) 159, 189
NlaIII CATG 2 cut(s) 64, 130
Sau3AI GATC 2 cut(s) 159, 189
SetI ASST 4 cut(s) 33, 99, 144, 208
TaaI ACNGT 1 cut(s) 181
TaqI TCGA 2 cut(s) 162, 192
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.