RchiOBHm_Chr5g0027821

Endoplasmic reticulum membrane protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
21663038 .. 21664146
1109 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ30736

Sequence Viewer

Length: 396 bp
ATGGGTGCCAAGACTGGATTGCTTGGTCTTGAAAGGCACTTTGCCTTCTATGGAGCATATCACAGCAACCCTGCTAACATTTTGATAGACTATGTTTGTATGGCCGTCACTTTTCATTGTTCTTGTTTTCTTCCACTTCACACCTTCTCTCTACAATCTCCTATCAGAGTTCAACAATCATGGCTTTGTGCCATGGGAACTTTGAGAAAAGAGCACCAGCTCTTATGGACAAACTTGCTCAAAGCCCTTCTAATGGGGCCTTACTTTGTTTTGCGTGTGGTTCTTCAATCAACTTTTGGGTATGAGCCTTATCCTGGGTTTCATGCAAGTGTGAAAGAGAAGATTGAAGCTGATACCAAAGAGTGGAAGGTTAAGAACCAAAAGAAACTCTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

131

Amino Acids

15.07

Weight (kDa)

9.23

Isoelectric Point (pI)

46.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 5
AccB7I CCANNNNNTGG 1 cut(s) 363
AcoI YGGCCR 1 cut(s) 102
AfiI CCNNNNNNNGG 3 cut(s) 253, 314, 363
AgsI TTSAA 4 cut(s) 32, 173, 287, 347
AjnI CCWGG 1 cut(s) 313
AluBI AGCT 2 cut(s) 220, 350
AluI AGCT 2 cut(s) 220, 350
Alw21I GWGCWC 1 cut(s) 216
AoxI GGCC 2 cut(s) 102, 257
AspS9I GGNCC 1 cut(s) 257
BanI GGYRCC 1 cut(s) 5
Bbv12I GWGCWC 1 cut(s) 216
BceAI ACGGC 1 cut(s) 89
BciT130I CCWGG 1 cut(s) 315
BfaI CTAG 1 cut(s) 394
Bme1390I CCNGG 1 cut(s) 315
BmgT120I GGNCC 1 cut(s) 257
BmiI GGNNCC 2 cut(s) 7, 258
BmrFI CCNGG 1 cut(s) 315
BsaJI CCNNGG 2 cut(s) 192, 314
Bsc4I CCNNNNNNNGG 3 cut(s) 253, 314, 363
Bse1I ACTGG 1 cut(s) 19
BseBI CCWGG 1 cut(s) 315
BseDI CCNNGG 2 cut(s) 192, 314
BseLI CCNNNNNNNGG 3 cut(s) 253, 314, 363
BseNI ACTGG 1 cut(s) 19
BshFI GGCC 2 cut(s) 104, 259
BshNI GGYRCC 1 cut(s) 5
BsiHKAI GWGCWC 1 cut(s) 216
BslI CCNNNNNNNGG 3 cut(s) 253, 314, 363
BsnI GGCC 2 cut(s) 104, 259
Bsp1286I GDGCHC 1 cut(s) 216
Bsp19I CCATGG 1 cut(s) 192
BspANI GGCC 2 cut(s) 104, 259
BspLI GGNNCC 2 cut(s) 7, 258
BspT107I GGYRCC 1 cut(s) 5
BsrI ACTGG 1 cut(s) 19
BssECI CCNNGG 2 cut(s) 192, 314
BssT1I CCWWGG 1 cut(s) 192
Bst2UI CCWGG 1 cut(s) 315
BstDSI CCRYGG 1 cut(s) 192
BstNI CCWGG 1 cut(s) 315
BstSCI CCNGG 1 cut(s) 313
BsuRI GGCC 2 cut(s) 104, 259
BtgI CCRYGG 1 cut(s) 192
Cfr13I GGNCC 1 cut(s) 257
CviAII CATG 3 cut(s) 180, 193, 323
CviJI RGCY 7 cut(s) 104, 184, 220, 245, 259, 307, 350
CviKI_1 RGCY 7 cut(s) 104, 184, 220, 245, 259, 307, 350
EaeI YGGCCR 1 cut(s) 102
Eco130I CCWWGG 1 cut(s) 192
EcoO109I RGGNCCY 1 cut(s) 257
EcoRII CCWGG 1 cut(s) 313
EcoT14I CCWWGG 1 cut(s) 192
ErhI CCWWGG 1 cut(s) 192
FaeI CATG 3 cut(s) 183, 196, 326
FaiI YATR 9 cut(s) 51, 58, 93, 101, 181, 194, 226, 303, 324
FatI CATG 3 cut(s) 179, 192, 322
FspBI CTAG 1 cut(s) 394
HaeIII GGCC 2 cut(s) 104, 259
Hin1II CATG 3 cut(s) 183, 196, 326
Hpy188I TCNGA 1 cut(s) 167
Hpy188III TCNNGA 1 cut(s) 29
HpyAV CCTTC 4 cut(s) 55, 154, 257, 361
HpyCH4V TGCA 1 cut(s) 326
Hsp92II CATG 3 cut(s) 183, 196, 326
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 4 cut(s) 84, 230, 300, 327
MaeI CTAG 1 cut(s) 394
MaeIII GTNAC 1 cut(s) 106
MboII GAAGA 3 cut(s) 122, 275, 352
MhlI GDGCHC 1 cut(s) 216
MseI TTAA 1 cut(s) 372
MslI CAYNNNNRTG 1 cut(s) 327
MspR9I CCNGG 1 cut(s) 315
MvaI CCWGG 1 cut(s) 315
NcoI CCATGG 1 cut(s) 192
NlaIII CATG 3 cut(s) 183, 196, 326
NlaIV GGNNCC 2 cut(s) 7, 258
NmuCI GTSAC 1 cut(s) 106
PflMI CCANNNNNTGG 1 cut(s) 363
Psp6I CCWGG 1 cut(s) 313
PspGI CCWGG 1 cut(s) 313
PspN4I GGNNCC 2 cut(s) 7, 258
PspPI GGNCC 1 cut(s) 257
RseI CAYNNNNRTG 1 cut(s) 327
SaqAI TTAA 1 cut(s) 372
Sau96I GGNCC 1 cut(s) 257
ScrFI CCNGG 1 cut(s) 315
SduI GDGCHC 1 cut(s) 216
SetI ASST 4 cut(s) 146, 222, 352, 372
SmiMI CAYNNNNRTG 1 cut(s) 327
SspMI CTAG 1 cut(s) 394
StyD4I CCNGG 1 cut(s) 313
StyI CCWWGG 1 cut(s) 192
Tru1I TTAA 1 cut(s) 372
Tru9I TTAA 1 cut(s) 372
TseFI GTSAC 1 cut(s) 106
Tsp45I GTSAC 1 cut(s) 106
TspDTI ATGAA 2 cut(s) 104, 311
Van91I CCANNNNNTGG 1 cut(s) 363
XspI CTAG 1 cut(s) 394
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.