Rmu_sc0003684.1_g000002

Pentatricopeptide repeat domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003684.1
Physical Location & Seq
Reverse (-)
3834 .. 4511
678 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003684.1_g000002.1.cds

Sequence Viewer

Length: 558 bp
atggtccacacccatcacctcaaaactgggttcttctccgacgtctacgcagccaccgctctcacgaacgcttccatgaagctcaacctcttggacaatgcactcaaagtgttcgatgaaatgcctcaccgaaacttggcacccgtaaacactgtgatttcctggttgttgcataatggacatcgcagagaggctttaaaggtgtgcaagagcgttggttttggatggctcaggttgaattcggttactatagctagtgtgttttcagcatgtgacaatgcgaagcaggggatgggaatggattgcgtggcggtgaagctcggggttaagagtgatgtttatgttgctacctcagctgtgagtatgtattggagctgtggggagttggccatggtttctgctgcaaagttgtttgaacatatgcctgtcaagaatgtggtgagctataatgcttttataacaaggcttttacagaatggggttccaagggtgcatggtttgatcatgaaagatgatggtatcgacgttggagttcggatgcggtggaagaggtggtag

Protein Analysis

185

Amino Acids

20.57

Weight (kDa)

9.51

Isoelectric Point (pI)

32.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 458
AatII GACGTC 1 cut(s) 45
AccB1I GGYRCC 1 cut(s) 139
AccBSI CCGCTC 1 cut(s) 59
AccI GTMKAC 1 cut(s) 45
AciI CCGC 3 cut(s) 57, 311, 541
AcoI YGGCCR 1 cut(s) 387
AcsI RAATTY 1 cut(s) 238
AcyI GRCGYC 1 cut(s) 42
AfiI CCNNNNNNNGG 1 cut(s) 136
AgsI TTSAA 2 cut(s) 238, 416
AjnI CCWGG 1 cut(s) 161
AluBI AGCT 6 cut(s) 82, 254, 319, 356, 375, 444
AluI AGCT 6 cut(s) 82, 254, 319, 356, 375, 444
Ama87I CYCGRG 1 cut(s) 320
AoxI GGCC 1 cut(s) 387
ApeKI GCWGC 2 cut(s) 50, 401
ApoI RAATTY 1 cut(s) 238
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 4 cut(s) 8, 119, 325, 451
AvaI CYCGRG 1 cut(s) 320
AvaII GGWCC 1 cut(s) 4
BalI TGGCCA 1 cut(s) 389
BanI GGYRCC 1 cut(s) 139
BbvCI CCTCAGC 1 cut(s) 352
BbvI GCAGC 2 cut(s) 62, 388
BccI CCATC 4 cut(s) 21, 219, 286, 509
BciT130I CCWGG 1 cut(s) 163
BclI TGATCA 1 cut(s) 501
BfaI CTAG 1 cut(s) 255
BfmI CTRYAG 1 cut(s) 249
BisI GCNGC 2 cut(s) 51, 402
BlsI GCNGC 2 cut(s) 52, 403
Bme1390I CCNGG 1 cut(s) 163
Bme18I GGWCC 1 cut(s) 4
BmeT110I CYCGRG 1 cut(s) 320
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 2 cut(s) 141, 483
BmrFI CCNGG 1 cut(s) 163
BmrI ACTGGG 1 cut(s) 36
BmsI GCATC 1 cut(s) 528
BmuI ACTGGG 1 cut(s) 36
Bpu10I CCTNAGC 2 cut(s) 230, 352
BsaHI GRCGYC 1 cut(s) 42
BsaJI CCNNGG 2 cut(s) 390, 485
Bsc4I CCNNNNNNNGG 1 cut(s) 136
Bse1I ACTGG 1 cut(s) 31
BseBI CCWGG 1 cut(s) 163
BseDI CCNNGG 2 cut(s) 390, 485
BseGI GGATG 3 cut(s) 230, 297, 543
BseLI CCNNNNNNNGG 1 cut(s) 136
BseMII CTCAG 2 cut(s) 244, 366
BseNI ACTGG 1 cut(s) 31
BseXI GCAGC 2 cut(s) 62, 388
BshFI GGCC 1 cut(s) 389
BshNI GGYRCC 1 cut(s) 139
BsiHKCI CYCGRG 1 cut(s) 320
BslI CCNNNNNNNGG 1 cut(s) 136
BsnI GGCC 1 cut(s) 389
BsoBI CYCGRG 1 cut(s) 320
Bsp143I GATC 1 cut(s) 501
Bsp19I CCATGG 1 cut(s) 390
BspACI CCGC 3 cut(s) 57, 311, 541
BspANI GGCC 1 cut(s) 389
BspCNI CTCAG 2 cut(s) 243, 365
BspHI TCATGA 1 cut(s) 504
BspLI GGNNCC 2 cut(s) 141, 483
BspT107I GGYRCC 1 cut(s) 139
BsrBI CCGCTC 1 cut(s) 59
BsrI ACTGG 1 cut(s) 31
BssECI CCNNGG 2 cut(s) 390, 485
BssMI GATC 1 cut(s) 501
BssNI GRCGYC 1 cut(s) 42
BssT1I CCWWGG 2 cut(s) 390, 485
Bst2UI CCWGG 1 cut(s) 163
Bst4CI ACNGT 1 cut(s) 154
Bst6I CTCTTC 1 cut(s) 542
BstACI GRCGYC 1 cut(s) 42
BstDEI CTNAG 2 cut(s) 230, 352
BstDSI CCRYGG 1 cut(s) 390
BstF5I GGATG 3 cut(s) 230, 297, 543
BstKTI GATC 1 cut(s) 504
BstMBI GATC 1 cut(s) 501
BstMWI GCNNNNNNNGC 2 cut(s) 56, 353
BstNI CCWGG 1 cut(s) 163
BstNSI RCATGY 1 cut(s) 273
BstSCI CCNGG 1 cut(s) 161
BstSFI CTRYAG 1 cut(s) 249
BstV1I GCAGC 2 cut(s) 62, 388
BsuRI GGCC 1 cut(s) 389
BtgI CCRYGG 1 cut(s) 390
BtgZI GCGATG 1 cut(s) 167
BtsCI GGATG 3 cut(s) 230, 297, 543
BtsIMutI CAGTG 1 cut(s) 150
CciI TCATGA 1 cut(s) 504
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 5 cut(s) 76, 270, 391, 494, 505
DdeI CTNAG 2 cut(s) 230, 352
DpnI GATC 1 cut(s) 503
DpnII GATC 1 cut(s) 501
DraI TTTAAA 1 cut(s) 198
EaeI YGGCCR 1 cut(s) 387
Eam1104I CTCTTC 1 cut(s) 542
EarI CTCTTC 1 cut(s) 542
Eco130I CCWWGG 2 cut(s) 390, 485
Eco47I GGWCC 1 cut(s) 4
Eco88I CYCGRG 1 cut(s) 320
EcoRI GAATTC 1 cut(s) 238
EcoRII CCWGG 1 cut(s) 161
EcoT14I CCWWGG 2 cut(s) 390, 485
ErhI CCWWGG 2 cut(s) 390, 485
FaeI CATG 5 cut(s) 79, 273, 394, 497, 508
FatI CATG 5 cut(s) 75, 269, 390, 493, 504
FauNDI CATATG 1 cut(s) 420
FbaI TGATCA 1 cut(s) 501
FblI GTMKAC 1 cut(s) 45
Fnu4HI GCNGC 2 cut(s) 51, 402
FokI GGATG 3 cut(s) 237, 304, 550
Fsp4HI GCNGC 2 cut(s) 51, 402
FspBI CTAG 1 cut(s) 255
GluI GCNGC 2 cut(s) 51, 402
HaeIII GGCC 1 cut(s) 389
Hin1I GRCGYC 1 cut(s) 42
Hin1II CATG 5 cut(s) 79, 273, 394, 497, 508
HphI GGTGA 4 cut(s) 8, 119, 325, 451
Hpy166II GTNNAC 3 cut(s) 7, 46, 148
Hpy188I TCNGA 2 cut(s) 40, 537
Hpy188III TCNNGA 3 cut(s) 64, 430, 505
Hpy8I GTNNAC 3 cut(s) 7, 46, 148
Hpy99I CGWCG 2 cut(s) 44, 527
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4IV ACGT 2 cut(s) 42, 525
HpyCH4V TGCA 5 cut(s) 101, 172, 207, 404, 493
HpyF10VI GCNNNNNNNGC 2 cut(s) 56, 353
HpyF3I CTNAG 2 cut(s) 230, 352
HpySE526I ACGT 2 cut(s) 42, 525
Hsp92I GRCGYC 1 cut(s) 42
Hsp92II CATG 5 cut(s) 79, 273, 394, 497, 508
Ksp22I TGATCA 1 cut(s) 501
Kzo9I GATC 1 cut(s) 501
LmnI GCTCC 1 cut(s) 372
LpnPI CCDG 6 cut(s) 12, 148, 175, 217, 272, 438
Lsp1109I GCAGC 2 cut(s) 62, 388
LweI GCATC 1 cut(s) 528
MaeI CTAG 1 cut(s) 255
MaeII ACGT 2 cut(s) 42, 525
MaeIII GTNAC 2 cut(s) 244, 272
MalI GATC 1 cut(s) 503
MbiI CCGCTC 1 cut(s) 59
MboI GATC 1 cut(s) 501
MboII GAAGA 1 cut(s) 25
MlsI TGGCCA 1 cut(s) 389
MluCI AATT 1 cut(s) 238
MluNI TGGCCA 1 cut(s) 389
MmeI TCCRAC 2 cut(s) 63, 508
MnlI CCTC 6 cut(s) 29, 98, 135, 184, 361, 543
Mox20I TGGCCA 1 cut(s) 389
MscI TGGCCA 1 cut(s) 389
MseI TTAA 2 cut(s) 197, 327
Msp20I TGGCCA 1 cut(s) 389
MspA1I CMGCKG 1 cut(s) 356
MspR9I CCNGG 1 cut(s) 163
MvaI CCWGG 1 cut(s) 163
MwoI GCNNNNNNNGC 2 cut(s) 56, 353
NcoI CCATGG 1 cut(s) 390
NdeI CATATG 1 cut(s) 420
NdeII GATC 1 cut(s) 501
NlaIII CATG 5 cut(s) 79, 273, 394, 497, 508
NlaIV GGNNCC 2 cut(s) 141, 483
NmuCI GTSAC 1 cut(s) 272
NspI RCATGY 1 cut(s) 273
PagI TCATGA 1 cut(s) 504
PkrI GCNGC 2 cut(s) 52, 403
PsiI TTATAA 1 cut(s) 458
Psp6I CCWGG 1 cut(s) 161
PspGI CCWGG 1 cut(s) 161
PspN4I GGNNCC 2 cut(s) 141, 483
PspPI GGNCC 1 cut(s) 4
PvuII CAGCTG 1 cut(s) 356
SaqAI TTAA 2 cut(s) 197, 327
SatI GCNGC 2 cut(s) 51, 402
Sau3AI GATC 1 cut(s) 501
Sau96I GGNCC 1 cut(s) 4
ScrFI CCNGG 1 cut(s) 163
SfaNI GCATC 1 cut(s) 528
SfcI CTRYAG 1 cut(s) 249
SinI GGWCC 1 cut(s) 4
Sse9I AATT 1 cut(s) 238
SsiI CCGC 3 cut(s) 57, 311, 541
SspMI CTAG 1 cut(s) 255
StyD4I CCNGG 1 cut(s) 161
StyI CCWWGG 2 cut(s) 390, 485
TaaI ACNGT 1 cut(s) 154
TaiI ACGT 2 cut(s) 45, 528
TaqI TCGA 2 cut(s) 114, 522
TasI AATT 1 cut(s) 238
Tru1I TTAA 2 cut(s) 197, 327
Tru9I TTAA 2 cut(s) 197, 327
TscAI CASTG 1 cut(s) 157
TseFI GTSAC 1 cut(s) 272
TseI GCWGC 2 cut(s) 50, 401
Tsp45I GTSAC 1 cut(s) 272
TspDTI ATGAA 3 cut(s) 92, 132, 521
TspRI CASTG 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 4
XapI RAATTY 1 cut(s) 238
XceI RCATGY 1 cut(s) 273
XmiI GTMKAC 1 cut(s) 45
XspI CTAG 1 cut(s) 255
ZraI GACGTC 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.