Rh5CG214100

Endoplasmic reticulum membrane protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0001126
Physical Location & Seq
Forward (+)
21691816 .. 21692275
460 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG214100.1

Sequence Viewer

Length: 192 bp
ATGGGAACTTTGAGAAAAGAGCACCAGCTCTTATGGACAAACTTGCTCAAAGCCCTTCTAATGGGGCCTTACTTTGTTTTGCGTGTAGTTCTTCAATCAACTTTTGGGTATGAGCCTTATCCTGGGTTTCATGCAAGTGTGAAAGAGAAGATTGAAGCTGATACCAAAGAGTGGAAGGAAAATTGCATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF962

Protein Analysis

63

Amino Acids

7.37

Weight (kDa)

7.89

Isoelectric Point (pI)

26.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 171
AfiI CCNNNNNNNGG 3 cut(s) 61, 122, 171
AgsI TTSAA 2 cut(s) 95, 155
AjnI CCWGG 1 cut(s) 121
AluBI AGCT 2 cut(s) 28, 158
AluI AGCT 2 cut(s) 28, 158
Alw21I GWGCWC 1 cut(s) 24
AoxI GGCC 1 cut(s) 65
AspS9I GGNCC 1 cut(s) 65
Bbv12I GWGCWC 1 cut(s) 24
BciT130I CCWGG 1 cut(s) 123
Bme1390I CCNGG 1 cut(s) 123
BmgT120I GGNCC 1 cut(s) 65
BmiI GGNNCC 1 cut(s) 66
BmrFI CCNGG 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 122
Bsc4I CCNNNNNNNGG 3 cut(s) 61, 122, 171
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 122
BseLI CCNNNNNNNGG 3 cut(s) 61, 122, 171
BshFI GGCC 1 cut(s) 67
BsiHKAI GWGCWC 1 cut(s) 24
BslI CCNNNNNNNGG 3 cut(s) 61, 122, 171
BsnI GGCC 1 cut(s) 67
Bsp1286I GDGCHC 1 cut(s) 24
BspANI GGCC 1 cut(s) 67
BspLI GGNNCC 1 cut(s) 66
BssECI CCNNGG 1 cut(s) 122
Bst2UI CCWGG 1 cut(s) 123
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BsuRI GGCC 1 cut(s) 67
Cfr13I GGNCC 1 cut(s) 65
CviAII CATG 1 cut(s) 131
CviJI RGCY 5 cut(s) 28, 53, 67, 115, 158
CviKI_1 RGCY 5 cut(s) 28, 53, 67, 115, 158
EcoO109I RGGNCCY 1 cut(s) 65
EcoRII CCWGG 1 cut(s) 121
FaeI CATG 1 cut(s) 134
FaiI YATR 5 cut(s) 34, 111, 132, 188, 190
FatI CATG 1 cut(s) 130
HaeIII GGCC 1 cut(s) 67
Hin1II CATG 1 cut(s) 134
HpyAV CCTTC 2 cut(s) 65, 169
HpyCH4V TGCA 2 cut(s) 134, 186
Hsp92II CATG 1 cut(s) 134
LpnPI CCDG 3 cut(s) 38, 108, 135
MboII GAAGA 2 cut(s) 83, 160
MhlI GDGCHC 1 cut(s) 24
MluCI AATT 1 cut(s) 181
MslI CAYNNNNRTG 1 cut(s) 135
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
NlaIII CATG 1 cut(s) 134
NlaIV GGNNCC 1 cut(s) 66
PflMI CCANNNNNTGG 1 cut(s) 171
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PspN4I GGNNCC 1 cut(s) 66
PspPI GGNCC 1 cut(s) 65
RseI CAYNNNNRTG 1 cut(s) 135
Sau96I GGNCC 1 cut(s) 65
ScrFI CCNGG 1 cut(s) 123
SduI GDGCHC 1 cut(s) 24
SetI ASST 2 cut(s) 30, 160
SgeI CNNG 7 cut(s) 37, 55, 95, 134, 135, 143, 147
SmiMI CAYNNNNRTG 1 cut(s) 135
Sse9I AATT 1 cut(s) 181
StyD4I CCNGG 1 cut(s) 121
TasI AATT 1 cut(s) 181
TspDTI ATGAA 1 cut(s) 119
Van91I CCANNNNNTGG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.