RchiOBHm_Chr5g0036811

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
31078514 .. 31080961
2448 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31561

Sequence Viewer

Length: 183 bp
ATGTTAGGAGGTATGAAGCTATGCATTAACAAATGGGGAACTCTGAGATTTCAAACCACTAACCTCTCTATTTTGATCAGTATCAGAAACTTTCTTTTGGATCAAGGGCTCAAGTGGACTGAAGATTGGTCCTTTGGTACTTGCTGGGAGTTGCACATCAAGGATTCCAGGTTAAGCTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

60

Amino Acids

7.03

Weight (kDa)

8.8

Isoelectric Point (pI)

32.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 108
AcuI CTGAAG 1 cut(s) 141
AfaI GTAC 1 cut(s) 139
AgsI TTSAA 1 cut(s) 53
AjnI CCWGG 1 cut(s) 167
AluBI AGCT 2 cut(s) 19, 177
AluI AGCT 2 cut(s) 19, 177
AlwI GGATC 1 cut(s) 108
AspS9I GGNCC 1 cut(s) 129
AvaII GGWCC 1 cut(s) 129
BanII GRGCYC 1 cut(s) 111
BciT130I CCWGG 1 cut(s) 169
BclI TGATCA 1 cut(s) 75
Bme1390I CCNGG 1 cut(s) 169
Bme18I GGWCC 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 169
BpuEI CTTGAG 1 cut(s) 95
BsaBI GATNNNNATC 1 cut(s) 80
Bse8I GATNNNNATC 1 cut(s) 80
BseBI CCWGG 1 cut(s) 169
BseJI GATNNNNATC 1 cut(s) 80
BseMII CTCAG 1 cut(s) 35
BseYI CCCAGC 1 cut(s) 144
Bsp1286I GDGCHC 1 cut(s) 111
Bsp143I GATC 2 cut(s) 75, 100
BspCNI CTCAG 1 cut(s) 36
BspPI GGATC 1 cut(s) 108
BssMI GATC 2 cut(s) 75, 100
Bst2UI CCWGG 1 cut(s) 169
BstDEI CTNAG 1 cut(s) 44
BstKTI GATC 2 cut(s) 78, 103
BstMBI GATC 2 cut(s) 75, 100
BstNI CCWGG 1 cut(s) 169
BstSCI CCNGG 1 cut(s) 167
Cfr13I GGNCC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 138
CviJI RGCY 3 cut(s) 19, 109, 177
CviKI_1 RGCY 3 cut(s) 19, 109, 177
CviQI GTAC 1 cut(s) 138
DdeI CTNAG 1 cut(s) 44
DpnI GATC 2 cut(s) 77, 102
DpnII GATC 2 cut(s) 75, 100
Eco24I GRGCYC 1 cut(s) 111
Eco47I GGWCC 1 cut(s) 129
Eco57I CTGAAG 1 cut(s) 141
EcoRII CCWGG 1 cut(s) 167
EcoT22I ATGCAT 1 cut(s) 26
EcoT38I GRGCYC 1 cut(s) 111
FaiI YATR 2 cut(s) 14, 22
FbaI TGATCA 1 cut(s) 75
FriOI GRGCYC 1 cut(s) 111
GsaI CCCAGC 1 cut(s) 148
HindIII AAGCTT 1 cut(s) 175
HinfI GANTC 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 117
Hpy188I TCNGA 2 cut(s) 45, 86
Hpy8I GTNNAC 1 cut(s) 117
HpyCH4V TGCA 2 cut(s) 24, 154
HpyF3I CTNAG 1 cut(s) 44
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 2 cut(s) 75, 100
LpnPI CCDG 2 cut(s) 130, 154
MalI GATC 2 cut(s) 77, 102
MboI GATC 2 cut(s) 75, 100
MboII GAAGA 1 cut(s) 134
MhlI GDGCHC 1 cut(s) 111
MnlI CCTC 1 cut(s) 74
Mph1103I ATGCAT 1 cut(s) 26
MseI TTAA 2 cut(s) 27, 173
MspR9I CCNGG 1 cut(s) 169
MvaI CCWGG 1 cut(s) 169
NdeII GATC 2 cut(s) 75, 100
NsiI ATGCAT 1 cut(s) 26
PfeI GAWTC 1 cut(s) 164
Psp6I CCWGG 1 cut(s) 167
PspFI CCCAGC 1 cut(s) 144
PspGI CCWGG 1 cut(s) 167
PspPI GGNCC 1 cut(s) 129
RsaI GTAC 1 cut(s) 139
RsaNI GTAC 1 cut(s) 138
SaqAI TTAA 2 cut(s) 27, 173
Sau3AI GATC 2 cut(s) 75, 100
Sau96I GGNCC 1 cut(s) 129
ScrFI CCNGG 1 cut(s) 169
SduI GDGCHC 1 cut(s) 111
SetI ASST 5 cut(s) 13, 21, 66, 173, 179
SgeI CNNG 5 cut(s) 116, 124, 153, 157, 172
SinI GGWCC 1 cut(s) 129
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 167
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 2 cut(s) 27, 173
Tru9I TTAA 2 cut(s) 27, 173
TspDTI ATGAA 1 cut(s) 29
VpaK11BI GGWCC 1 cut(s) 129
Zsp2I ATGCAT 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.