Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007678.1

Orthogroup ID

OG0000819

Physical Location & Seq

Genomic Coordinates Reverse (-)

63712 .. 67856

Gene Structure 4145 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007678.1_g000015.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 783 bp

atgggcgatcttgggccttggtcgcctgggccaaacggcgtcgtttcggaggagaggctgacctcgtcttcgtcgtccgtgttttcaatttcaaccaatcagagggaggactggcggagagcggaggaggcgacgcagggggttatagctcaggtccagcctactcacgtctccgagcggagaaggaaggccgtcattgattacgtccagaggctcattggaggttgtcttgtttgcaaggtgttcccgtttggatcagtacctctgaagacgtatctcccggatggagatattgatctgactgcttttggtggtctaaatagtgaggagtcactggccaatgatgtctgtgctgttcttgaaagtgaaggtcacaatatggctgctgagtttgtggtgaaggatgtgcagttaattcgggctgaggttaagcttgtaaagtgccttgtgcaaaatattgtggttgatatatccttcaatcagttaggagggctatgcgtgatggagcgaagcaatccgagtagaggcgtgcagcgaatgtttataagatctcaatatgactccgataaggcttccgaactagacgtttcgaggcttgcaagaagacggatgtgcacagtaacgggaaaaagatgcagtgggtgcgttggcttgtttgcgcagcagggatgcttcggtggcagcaggctggaacgtagggctgcaggaagggggcagcaggggttgctgtgcaaggttgctgcaagcacacgggcgctcgggctgcagcgaaggctcggctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

260

Amino Acids

28.33

Weight (kDa)

8.99

Isoelectric Point (pI)

55.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000819)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G64750 AT1G64750 AT1G64750 AT5G45010
fragaria_vesca	FvH4_5g05150 FvH4_6g50520
malus_domestica	MD06G1177000.v1.1 MD08G1129000.v1.1 MD09G1035600.v1.1 MD14G1183200.v1.1
prunus_persica	Prupe.3G282400_v2.0.a1 Prupe.3G282400_v2.0.a1 Prupe.5G175700_v2.0.a1
pyrus_communis	pycom06g15710 pycom11g08620 pycom14g15210
rosa_chinensis	RchiOBHm_Chr1g0343851 RchiOBHm_Chr2g0112011 RchiOBHm_Chr2g0170951 RchiOBHm_Chr5g0036811 RchiOBHm_Chr5g0042801 RchiOBHm_Chr5g0057591 RchiOBHm_Chr5g0071001 RchiOBHm_Chr7g0184521 RchiOBHm_Chr7g0193821
rosa_laevigata	RLG00000021995
rosa_multiflora	Rmu_sc0000695.1_g000001 Rmu_sc0001010.1_g000075 Rmu_sc0001214.1_g000046 Rmu_sc0001436.1_g000030 Rmu_sc0002806.1_g000028 Rmu_sc0003522.1_g000035 Rmu_sc0007678.1_g000015 Rmu_sc0010716.1_g000004
rosa_roxburghii	Rroxscaffold_2G00080950 Rroxscaffold_3G00242680 Rroxscaffold_3G00261800 Rroxscaffold_4G00331170
rosa_rugosa	Rorug01G0046300 Rorug02G0552600 Rorug02G0552700 Rorug02G0564600 Rorug05G0208000 Rorug05G0208100 Rorug06G0106700 Rorug07G0012300
rosa_samantha	Rh1CG011100 Rh1CG085000 Rh2CG099600 Rh2DG172400 Rh2DG554400 Rh2DG647800 Rh4AG144500 Rh5AG374300 Rh5AG374400 Rh5AG422100 Rh7AG138900 Rh7AG342100 Rh7AG360400 Rh7CG320000
rosa_wichuraiana	Rw2G027910 Rw2G051800 Rw4G015770 Rw5G001030 Rw5G037950 Rw6G008270 Rw7G011840 Rw7G039430

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	545
Acc16I	TGCGCA	1 cut(s)	660
AccBSI	CCGCTC	2 cut(s)	122, 178
AciI	CCGC	3 cut(s)	115, 122, 178
AclWI	GGATC	1 cut(s)	262
AcoI	YGGCCR	1 cut(s)	336
AcuI	CTGAAG	1 cut(s)	287
AcyI	GRCGYC	1 cut(s)	39
AfaI	GTAC	1 cut(s)	261
AfiI	CCNNNNNNNGG	2 cut(s)	102, 524
AgsI	TTSAA	4 cut(s)	87, 93, 362, 478
AjiI	CACGTC	1 cut(s)	169
AjnI	CCWGG	1 cut(s)	25
AluBI	AGCT	2 cut(s)	149, 433
AluI	AGCT	2 cut(s)	149, 433
Alw21I	GWGCWC	1 cut(s)	617
Alw26I	GTCTC	1 cut(s)	175
Alw44I	GTGCAC	1 cut(s)	613
AlwI	GGATC	1 cut(s)	262
Ama87I	CYCGRG	1 cut(s)	758
AoxI	GGCC	4 cut(s)	14, 29, 189, 336
ApaLI	GTGCAC	1 cut(s)	613
ApeKI	GCWGC	9 cut(s)	383, 532, 661, 681, 701, 715, 740, 763, 766
ArsI	GACNNNNNNTTYG	2 cut(s)	52, 84
AspLEI	GCGC	2 cut(s)	661, 757
AspS9I	GGNCC	3 cut(s)	14, 29, 154
AsuC2I	CCSGG	1 cut(s)	281
AsuHPI	GGTGA	1 cut(s)	409
AvaI	CYCGRG	1 cut(s)	758
AvaII	GGWCC	1 cut(s)	154
BaeGI	GKGCMC	1 cut(s)	617
BalI	TGGCCA	1 cut(s)	338
BbsI	GAAGAC	3 cut(s)	60, 275, 610
Bbv12I	GWGCWC	1 cut(s)	617
BbvCI	CCTCAGC	1 cut(s)	423
BbvI	GCAGC	9 cut(s)	370, 544, 673, 688, 693, 727, 727, 750, 778
BccI	CCATC	2 cut(s)	278, 496
BceAI	ACGGC	2 cut(s)	52, 176
BcgI	CGANNNNNNTGC	2 cut(s)	398, 432
BciT130I	CCWGG	1 cut(s)	27
BcnI	CCSGG	1 cut(s)	281
BcoDI	GTCTC	1 cut(s)	175
BfaI	CTAG	2 cut(s)	581, 781
BfmI	CTRYAG	2 cut(s)	702, 764
BfoI	RGCGCY	1 cut(s)	758
BglII	AGATCT	1 cut(s)	548
BisI	GCNGC	9 cut(s)	384, 533, 662, 682, 702, 716, 741, 764, 767
BlsI	GCNGC	9 cut(s)	385, 534, 663, 683, 703, 717, 742, 765, 768
Bme1390I	CCNGG	2 cut(s)	27, 281
Bme18I	GGWCC	1 cut(s)	154
BmeT110I	CYCGRG	1 cut(s)	758
BmgBI	CACGTC	1 cut(s)	169
BmgT120I	GGNCC	3 cut(s)	14, 29, 154
BmrFI	CCNGG	2 cut(s)	27, 281
BmsI	GCATC	2 cut(s)	623, 659
BpiI	GAAGAC	3 cut(s)	60, 275, 610
Bpu10I	CCTNAGC	2 cut(s)	150, 423
BpuMI	CCSGG	1 cut(s)	281
BsaBI	GATNNNNATC	1 cut(s)	294
BsaHI	GRCGYC	1 cut(s)	39
BsaJI	CCNNGG	2 cut(s)	17, 26
Bsc4I	CCNNNNNNNGG	2 cut(s)	102, 524
Bse1I	ACTGG	2 cut(s)	116, 339
Bse8I	GATNNNNATC	1 cut(s)	294
BseBI	CCWGG	1 cut(s)	27
BseDI	CCNNGG	2 cut(s)	17, 26
BseGI	GGATG	4 cut(s)	289, 409, 615, 674
BseJI	GATNNNNATC	1 cut(s)	294
BseLI	CCNNNNNNNGG	2 cut(s)	102, 524
BseMII	CTCAG	3 cut(s)	164, 378, 414
BseNI	ACTGG	2 cut(s)	116, 339
BseRI	GAGGAG	3 cut(s)	65, 140, 341
BseSI	GKGCMC	1 cut(s)	617
BseXI	GCAGC	9 cut(s)	370, 544, 673, 688, 693, 727, 727, 750, 778
BsgI	GTGCAG	2 cut(s)	428, 551
BshFI	GGCC	4 cut(s)	16, 31, 191, 338
BsiHKAI	GWGCWC	1 cut(s)	617
BsiHKCI	CYCGRG	1 cut(s)	758
BsiSI	CCGG	1 cut(s)	281
BslI	CCNNNNNNNGG	2 cut(s)	102, 524
BsmAI	GTCTC	1 cut(s)	175
BsmBI	CGTCTC	1 cut(s)	175
BsnI	GGCC	4 cut(s)	16, 31, 191, 338
BsoBI	CYCGRG	1 cut(s)	758
Bsp1286I	GDGCHC	1 cut(s)	617
Bsp143I	GATC	4 cut(s)	7, 254, 295, 548
BspACI	CCGC	3 cut(s)	115, 122, 178
BspANI	GGCC	4 cut(s)	16, 31, 191, 338
BspCNI	CTCAG	3 cut(s)	163, 379, 415
BspMAI	CTGCAG	2 cut(s)	706, 768
BspPI	GGATC	1 cut(s)	262
BsrBI	CCGCTC	2 cut(s)	122, 178
BsrI	ACTGG	2 cut(s)	116, 339
BssECI	CCNNGG	2 cut(s)	17, 26
BssMI	GATC	4 cut(s)	7, 254, 295, 548
BssNI	GRCGYC	1 cut(s)	39
BssT1I	CCWWGG	1 cut(s)	17
Bst2UI	CCWGG	1 cut(s)	27
Bst4CI	ACNGT	1 cut(s)	619
BstACI	GRCGYC	1 cut(s)	39
BstAPI	GCANNNNNTGC	2 cut(s)	642, 724
BstC8I	GCNNGC	4 cut(s)	530, 597, 686, 745
BstDEI	CTNAG	3 cut(s)	150, 387, 423
BstF5I	GGATG	4 cut(s)	289, 409, 615, 674
BstH2I	RGCGCY	1 cut(s)	758
BstHHI	GCGC	2 cut(s)	661, 757
BstKTI	GATC	4 cut(s)	10, 257, 298, 551
BstMAI	GTCTC	1 cut(s)	175
BstMBI	GATC	4 cut(s)	7, 254, 295, 548
BstMWI	GCNNNNNNNGC	7 cut(s)	22, 128, 642, 678, 724, 763, 772
BstNI	CCWGG	1 cut(s)	27
BstSCI	CCNGG	2 cut(s)	25, 279
BstSFI	CTRYAG	2 cut(s)	702, 764
BstSLI	GKGCMC	1 cut(s)	617
BstV1I	GCAGC	9 cut(s)	370, 544, 673, 688, 693, 727, 727, 750, 778
BstV2I	GAAGAC	3 cut(s)	60, 275, 610
BstX2I	RGATCY	1 cut(s)	548
BstYI	RGATCY	1 cut(s)	548
BsuRI	GGCC	4 cut(s)	16, 31, 191, 338
BtrI	CACGTC	1 cut(s)	169
BtsCI	GGATG	4 cut(s)	289, 409, 615, 674
BtsI	GCAGTG	1 cut(s)	643
BtsIMutI	CAGTG	2 cut(s)	332, 643
Cac8I	GCNNGC	4 cut(s)	530, 597, 686, 745
CfoI	GCGC	2 cut(s)	661, 757
Cfr13I	GGNCC	3 cut(s)	14, 29, 154
CseI	GACGC	2 cut(s)	28, 142
Csp6I	GTAC	1 cut(s)	260
CviQI	GTAC	1 cut(s)	260
DdeI	CTNAG	3 cut(s)	150, 387, 423
DpnI	GATC	4 cut(s)	9, 256, 297, 550
DpnII	GATC	4 cut(s)	7, 254, 295, 548
EaeI	YGGCCR	1 cut(s)	336
EciI	GGCGGA	1 cut(s)	130
Eco130I	CCWWGG	1 cut(s)	17
Eco47I	GGWCC	1 cut(s)	154
Eco57I	CTGAAG	1 cut(s)	287
Eco88I	CYCGRG	1 cut(s)	758
EcoRII	CCWGG	1 cut(s)	25
EcoT14I	CCWWGG	1 cut(s)	17
ErhI	CCWWGG	1 cut(s)	17
Esp3I	CGTCTC	1 cut(s)	175
FaiI	YATR	6 cut(s)	146, 380, 470, 496, 545, 558
Fnu4HI	GCNGC	9 cut(s)	384, 533, 662, 682, 702, 716, 741, 764, 767
FokI	GGATG	4 cut(s)	296, 416, 622, 681
Fsp4HI	GCNGC	9 cut(s)	384, 533, 662, 682, 702, 716, 741, 764, 767
FspBI	CTAG	2 cut(s)	581, 781
FspI	TGCGCA	1 cut(s)	660
GlaI	GCGC	2 cut(s)	660, 756
GluI	GCNGC	9 cut(s)	384, 533, 662, 682, 702, 716, 741, 764, 767
HaeII	RGCGCY	1 cut(s)	758
HaeIII	GGCC	4 cut(s)	16, 31, 191, 338
HapII	CCGG	1 cut(s)	281
HgaI	GACGC	2 cut(s)	28, 142
HhaI	GCGC	2 cut(s)	661, 757
Hin1I	GRCGYC	1 cut(s)	39
Hin6I	GCGC	2 cut(s)	659, 755
HinP1I	GCGC	2 cut(s)	659, 755
HindIII	AAGCTT	1 cut(s)	431
HinfI	GANTC	2 cut(s)	329, 560
HpaII	CCGG	1 cut(s)	281
HphI	GGTGA	1 cut(s)	409
Hpy166II	GTNNAC	1 cut(s)	615
Hpy188I	TCNGA	8 cut(s)	49, 102, 175, 267, 300, 519, 565, 577
Hpy188III	TCNNGA	2 cut(s)	208, 359
Hpy8I	GTNNAC	1 cut(s)	615
Hpy99I	CGWCG	3 cut(s)	44, 76, 136
HpyAV	CCTTC	7 cut(s)	177, 181, 362, 394, 484, 702, 765
HpyCH4III	ACNGT	1 cut(s)	619
HpyCH4IV	ACGT	5 cut(s)	168, 204, 272, 585, 694
HpyF10VI	GCNNNNNNNGC	7 cut(s)	22, 128, 642, 678, 724, 763, 772
HpyF3I	CTNAG	3 cut(s)	150, 387, 423
HpySE526I	ACGT	5 cut(s)	168, 204, 272, 585, 694
Hsp92I	GRCGYC	1 cut(s)	39
HspAI	GCGC	2 cut(s)	659, 755
Kzo9I	GATC	4 cut(s)	7, 254, 295, 548
LmnI	GCTCC	1 cut(s)	505
Lsp1109I	GCAGC	9 cut(s)	370, 544, 673, 688, 693, 727, 727, 750, 778
LweI	GCATC	2 cut(s)	623, 659
MaeI	CTAG	2 cut(s)	581, 781
MaeII	ACGT	5 cut(s)	168, 204, 272, 585, 694
MaeIII	GTNAC	3 cut(s)	330, 371, 619
MalI	GATC	4 cut(s)	9, 256, 297, 550
MbiI	CCGCTC	2 cut(s)	122, 178
MboI	GATC	4 cut(s)	7, 254, 295, 548
MboII	GAAGA	3 cut(s)	60, 280, 615
MflI	RGATCY	1 cut(s)	548
MhlI	GDGCHC	1 cut(s)	617
MlsI	TGGCCA	1 cut(s)	338
MluCI	AATT	2 cut(s)	87, 414
MluNI	TGGCCA	1 cut(s)	338
MlyI	GAGTC	2 cut(s)	338, 554
Mox20I	TGGCCA	1 cut(s)	338
MscI	TGGCCA	1 cut(s)	338
MseI	TTAA	2 cut(s)	413, 429
Msp20I	TGGCCA	1 cut(s)	338
MspI	CCGG	1 cut(s)	281
MspR9I	CCNGG	2 cut(s)	27, 281
MvaI	CCWGG	1 cut(s)	27
MwoI	GCNNNNNNNGC	7 cut(s)	22, 128, 642, 678, 724, 763, 772
NciI	CCSGG	1 cut(s)	281
NdeII	GATC	4 cut(s)	7, 254, 295, 548
NmeAIII	GCCGAG	1 cut(s)	756
NmuCI	GTSAC	2 cut(s)	330, 371
NsbI	TGCGCA	1 cut(s)	660
PcsI	WCGNNNNNNNCGW	1 cut(s)	71
PflFI	GACNNNGTC	1 cut(s)	64
PfoI	TCCNGGA	1 cut(s)	279
PkrI	GCNGC	9 cut(s)	385, 534, 663, 683, 703, 717, 742, 765, 768
PleI	GAGTC	2 cut(s)	337, 554
PpsI	GAGTC	2 cut(s)	337, 554
PsiI	TTATAA	1 cut(s)	545
Psp6I	CCWGG	1 cut(s)	25
PspGI	CCWGG	1 cut(s)	25
PspPI	GGNCC	3 cut(s)	14, 29, 154
PstI	CTGCAG	2 cut(s)	706, 768
PsuI	RGATCY	1 cut(s)	548
PsyI	GACNNNGTC	1 cut(s)	64
RsaI	GTAC	1 cut(s)	261
RsaNI	GTAC	1 cut(s)	260
SaqAI	TTAA	2 cut(s)	413, 429
SatI	GCNGC	9 cut(s)	384, 533, 662, 682, 702, 716, 741, 764, 767
Sau3AI	GATC	4 cut(s)	7, 254, 295, 548
Sau96I	GGNCC	3 cut(s)	14, 29, 154
SchI	GAGTC	2 cut(s)	338, 554
ScrFI	CCNGG	2 cut(s)	27, 281
SduI	GDGCHC	1 cut(s)	617
SfaNI	GCATC	2 cut(s)	623, 659
SfcI	CTRYAG	2 cut(s)	702, 764
SinI	GGWCC	1 cut(s)	154
Sse9I	AATT	2 cut(s)	87, 414
SsiI	CCGC	3 cut(s)	115, 122, 178
SspI	AATATT	1 cut(s)	457
SspMI	CTAG	2 cut(s)	581, 781
StyD4I	CCNGG	2 cut(s)	25, 279
StyI	CCWWGG	1 cut(s)	17
TaaI	ACNGT	1 cut(s)	619
TaiI	ACGT	5 cut(s)	171, 207, 275, 588, 697
TaqI	TCGA	1 cut(s)	590
TasI	AATT	2 cut(s)	87, 414
Tru1I	TTAA	2 cut(s)	413, 429
Tru9I	TTAA	2 cut(s)	413, 429
TscAI	CASTG	2 cut(s)	339, 643
TseFI	GTSAC	2 cut(s)	330, 371
TseI	GCWGC	9 cut(s)	383, 532, 661, 681, 701, 715, 740, 763, 766
Tsp45I	GTSAC	2 cut(s)	330, 371
TspGWI	ACGGA	2 cut(s)	67, 622
TspRI	CASTG	2 cut(s)	339, 643
Tth111I	GACNNNGTC	1 cut(s)	64
VneI	GTGCAC	1 cut(s)	613
VpaK11BI	GGWCC	1 cut(s)	154
XcmI	CCANNNNNNNNNTGG	1 cut(s)	215
XspI	CTAG	2 cut(s)	581, 781

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.