Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001214.1

Orthogroup ID

OG0000819

Physical Location & Seq

Genomic Coordinates Reverse (-)

187472 .. 189457

Gene Structure 1986 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001214.1_g000046.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 582 bp

atggagaaggatcaaaaggtagcatctgaagaccccaaggtggatatgttcgaggacgatgacgagtttgaagagttcaacatcaatctagacgttgtgagaaattctaaaactttgataggcgatcttaggccatggtcgcttgagccaaacgacgccgttttggaggagaggccgacctcatcttcttcatccatgttttcaatttcaacaaataagagggacgtttccgccgagtactggaggagagcggagggggcaatgcagggggttatagctcagatccaacgtactcacgtctctgagcggagaaggaaagccgccattgattacgttcagaggatcattggagcttgtattggtgttcccgtttggatcagtacctctgaagacgtatctgcaggatggagtgctgttcttgaaagggaagatcacaatatggctgctgagtttatggtgaaggacgtgcagttaattcgggcaaagaccctcttacaaccagacactcaattgacaaaacaagctacttctcctctctttccattccgctcccactcttctcttaagctcagaaacacttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

193

Amino Acids

21.93

Weight (kDa)

5.2

Isoelectric Point (pI)

55.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000819)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G64750 AT1G64750 AT1G64750 AT5G45010
fragaria_vesca	FvH4_5g05150 FvH4_6g50520
malus_domestica	MD06G1177000.v1.1 MD08G1129000.v1.1 MD09G1035600.v1.1 MD14G1183200.v1.1
prunus_persica	Prupe.3G282400_v2.0.a1 Prupe.3G282400_v2.0.a1 Prupe.5G175700_v2.0.a1
pyrus_communis	pycom06g15710 pycom11g08620 pycom14g15210
rosa_chinensis	RchiOBHm_Chr1g0343851 RchiOBHm_Chr2g0112011 RchiOBHm_Chr2g0170951 RchiOBHm_Chr5g0036811 RchiOBHm_Chr5g0042801 RchiOBHm_Chr5g0057591 RchiOBHm_Chr5g0071001 RchiOBHm_Chr7g0184521 RchiOBHm_Chr7g0193821
rosa_laevigata	RLG00000021995
rosa_multiflora	Rmu_sc0000695.1_g000001 Rmu_sc0001010.1_g000075 Rmu_sc0001214.1_g000046 Rmu_sc0001436.1_g000030 Rmu_sc0002806.1_g000028 Rmu_sc0003522.1_g000035 Rmu_sc0007678.1_g000015 Rmu_sc0010716.1_g000004
rosa_roxburghii	Rroxscaffold_2G00080950 Rroxscaffold_3G00242680 Rroxscaffold_3G00261800 Rroxscaffold_4G00331170
rosa_rugosa	Rorug01G0046300 Rorug02G0552600 Rorug02G0552700 Rorug02G0564600 Rorug05G0208000 Rorug05G0208100 Rorug06G0106700 Rorug07G0012300
rosa_samantha	Rh1CG011100 Rh1CG085000 Rh2CG099600 Rh2DG172400 Rh2DG554400 Rh2DG647800 Rh4AG144500 Rh5AG374300 Rh5AG374400 Rh5AG422100 Rh7AG138900 Rh7AG342100 Rh7AG360400 Rh7CG320000
rosa_wichuraiana	Rw2G027910 Rw2G051800 Rw4G015770 Rw5G001030 Rw5G037950 Rw6G008270 Rw7G011840 Rw7G039430

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	3 cut(s)	251, 307, 549
AciI	CCGC	5 cut(s)	231, 251, 307, 321, 547
AclWI	GGATC	4 cut(s)	18, 277, 350, 383
AcsI	RAATTY	1 cut(s)	103
AcuI	CTGAAG	2 cut(s)	48, 408
AcyI	GRCGYC	1 cut(s)	156
AfaI	GTAC	3 cut(s)	239, 292, 382
AfiI	CCNNNNNNNGG	2 cut(s)	40, 240
AflII	CTTAAG	1 cut(s)	563
AgsI	TTSAA	5 cut(s)	71, 79, 204, 210, 422
AjiI	CACGTC	2 cut(s)	298, 466
AluBI	AGCT	4 cut(s)	278, 353, 524, 568
AluI	AGCT	4 cut(s)	278, 353, 524, 568
Alw26I	GTCTC	1 cut(s)	304
AlwI	GGATC	4 cut(s)	18, 277, 350, 383
AoxI	GGCC	2 cut(s)	131, 173
ApeKI	GCWGC	1 cut(s)	443
ApoI	RAATTY	1 cut(s)	103
AsuHPI	GGTGA	1 cut(s)	469
BbsI	GAAGAC	2 cut(s)	36, 396
BbvI	GCAGC	1 cut(s)	430
BccI	CCATC	1 cut(s)	399
BceAI	ACGGC	1 cut(s)	143
BcgI	CGANNNNNNTGC	2 cut(s)	458, 492
BcoDI	GTCTC	1 cut(s)	304
BfaI	CTAG	1 cut(s)	89
BfmI	CTRYAG	1 cut(s)	399
BfrI	CTTAAG	1 cut(s)	563
BisI	GCNGC	2 cut(s)	321, 444
BlsI	GCNGC	2 cut(s)	322, 445
BmcAI	AGTACT	1 cut(s)	239
BmgBI	CACGTC	2 cut(s)	298, 466
BmsI	GCATC	1 cut(s)	32
BpiI	GAAGAC	2 cut(s)	36, 396
BpmI	CTGGAG	1 cut(s)	262
BpuEI	CTTGAG	1 cut(s)	164
BsaHI	GRCGYC	1 cut(s)	156
BsaJI	CCNNGG	2 cut(s)	36, 134
Bsc4I	CCNNNNNNNGG	2 cut(s)	40, 240
Bse1I	ACTGG	1 cut(s)	245
Bse3DI	GCAATG	1 cut(s)	267
BseDI	CCNNGG	2 cut(s)	36, 134
BseGI	GGATG	2 cut(s)	191, 410
BseLI	CCNNNNNNNGG	2 cut(s)	40, 240
BseMI	GCAATG	1 cut(s)	267
BseMII	CTCAG	3 cut(s)	293, 294, 438
BseNI	ACTGG	1 cut(s)	245
BseRI	GAGGAG	3 cut(s)	182, 259, 522
BseXI	GCAGC	1 cut(s)	430
BsgI	GTGCAG	1 cut(s)	488
BshFI	GGCC	2 cut(s)	133, 175
BslFI	GGGAC	1 cut(s)	236
BslI	CCNNNNNNNGG	2 cut(s)	40, 240
BsmAI	GTCTC	1 cut(s)	304
BsmBI	CGTCTC	1 cut(s)	304
BsmFI	GGGAC	1 cut(s)	236
BsnI	GGCC	2 cut(s)	133, 175
Bsp143I	GATC	6 cut(s)	10, 124, 282, 342, 375, 430
Bsp19I	CCATGG	1 cut(s)	134
BspACI	CCGC	5 cut(s)	231, 251, 307, 321, 547
BspANI	GGCC	2 cut(s)	133, 175
BspCNI	CTCAG	4 cut(s)	292, 295, 439, 582
BspMAI	CTGCAG	1 cut(s)	403
BspPI	GGATC	4 cut(s)	18, 277, 350, 383
BspTI	CTTAAG	1 cut(s)	563
BsrBI	CCGCTC	3 cut(s)	251, 307, 549
BsrDI	GCAATG	1 cut(s)	267
BsrI	ACTGG	1 cut(s)	245
BssECI	CCNNGG	2 cut(s)	36, 134
BssMI	GATC	6 cut(s)	10, 124, 282, 342, 375, 430
BssNI	GRCGYC	1 cut(s)	156
BssT1I	CCWWGG	2 cut(s)	36, 134
Bst6I	CTCTTC	2 cut(s)	66, 562
BstACI	GRCGYC	1 cut(s)	156
BstAFI	CTTAAG	1 cut(s)	563
BstDEI	CTNAG	5 cut(s)	128, 279, 303, 447, 569
BstDSI	CCRYGG	1 cut(s)	134
BstF5I	GGATG	2 cut(s)	191, 410
BstKTI	GATC	6 cut(s)	13, 127, 285, 345, 378, 433
BstMAI	GTCTC	1 cut(s)	304
BstMBI	GATC	6 cut(s)	10, 124, 282, 342, 375, 430
BstMWI	GCNNNNNNNGC	2 cut(s)	139, 257
BstSFI	CTRYAG	1 cut(s)	399
BstV1I	GCAGC	1 cut(s)	430
BstV2I	GAAGAC	2 cut(s)	36, 396
BstX2I	RGATCY	1 cut(s)	282
BstYI	RGATCY	1 cut(s)	282
BsuRI	GGCC	2 cut(s)	133, 175
BtgI	CCRYGG	1 cut(s)	134
BtrI	CACGTC	2 cut(s)	298, 466
BtsCI	GGATG	2 cut(s)	191, 410
CseI	GACGC	1 cut(s)	164
Csp6I	GTAC	3 cut(s)	238, 291, 381
CviAII	CATG	2 cut(s)	135, 196
CviJI	RGCY	9 cut(s)	133, 148, 175, 278, 320, 353, 443, 524, 568
CviKI_1	RGCY	9 cut(s)	133, 148, 175, 278, 320, 353, 443, 524, 568
CviQI	GTAC	3 cut(s)	238, 291, 381
DdeI	CTNAG	5 cut(s)	128, 279, 303, 447, 569
DpnI	GATC	6 cut(s)	12, 126, 284, 344, 377, 432
DpnII	GATC	6 cut(s)	10, 124, 282, 342, 375, 430
Eam1104I	CTCTTC	2 cut(s)	66, 562
EarI	CTCTTC	2 cut(s)	66, 562
EciI	GGCGGA	1 cut(s)	220
Eco130I	CCWWGG	2 cut(s)	36, 134
Eco57I	CTGAAG	2 cut(s)	48, 408
EcoT14I	CCWWGG	2 cut(s)	36, 134
ErhI	CCWWGG	2 cut(s)	36, 134
Esp3I	CGTCTC	1 cut(s)	304
FaeI	CATG	2 cut(s)	138, 199
FaiI	YATR	6 cut(s)	47, 136, 197, 275, 440, 455
FalI	AAGNNNNNCTT	2 cut(s)	476, 508
FaqI	GGGAC	1 cut(s)	236
FatI	CATG	2 cut(s)	134, 195
Fnu4HI	GCNGC	2 cut(s)	321, 444
FokI	GGATG	2 cut(s)	178, 417
Fsp4HI	GCNGC	2 cut(s)	321, 444
FspBI	CTAG	1 cut(s)	89
GluI	GCNGC	2 cut(s)	321, 444
GsuI	CTGGAG	1 cut(s)	262
HaeIII	GGCC	2 cut(s)	133, 175
HgaI	GACGC	1 cut(s)	164
Hin1I	GRCGYC	1 cut(s)	156
Hin1II	CATG	2 cut(s)	138, 199
HphI	GGTGA	1 cut(s)	469
Hpy188I	TCNGA	6 cut(s)	28, 282, 304, 339, 388, 572
Hpy188III	TCNNGA	2 cut(s)	89, 419
Hpy99I	CGWCG	1 cut(s)	158
HpyAV	CCTTC	2 cut(s)	306, 454
HpyCH4IV	ACGT	7 cut(s)	93, 225, 289, 297, 333, 393, 465
HpyCH4V	TGCA	3 cut(s)	265, 401, 469
HpyF10VI	GCNNNNNNNGC	2 cut(s)	139, 257
HpyF3I	CTNAG	5 cut(s)	128, 279, 303, 447, 569
HpySE526I	ACGT	7 cut(s)	93, 225, 289, 297, 333, 393, 465
Hsp92I	GRCGYC	1 cut(s)	156
Hsp92II	CATG	2 cut(s)	138, 199
Kzo9I	GATC	6 cut(s)	10, 124, 282, 342, 375, 430
LmnI	GCTCC	2 cut(s)	350, 554
LpnPI	CCDG	4 cut(s)	226, 251, 387, 513
Lsp1109I	GCAGC	1 cut(s)	430
LweI	GCATC	1 cut(s)	32
MaeI	CTAG	1 cut(s)	89
MaeII	ACGT	7 cut(s)	93, 225, 289, 297, 333, 393, 465
MalI	GATC	6 cut(s)	12, 126, 284, 344, 377, 432
MbiI	CCGCTC	3 cut(s)	251, 307, 549
MboI	GATC	6 cut(s)	10, 124, 282, 342, 375, 430
MboII	GAAGA	7 cut(s)	41, 83, 177, 180, 401, 440, 549
MfeI	CAATTG	1 cut(s)	509
MflI	RGATCY	1 cut(s)	282
MluCI	AATT	4 cut(s)	103, 204, 474, 509
MmeI	TCCRAC	1 cut(s)	310
MseI	TTAA	2 cut(s)	473, 564
MspCI	CTTAAG	1 cut(s)	563
MunI	CAATTG	1 cut(s)	509
MwoI	GCNNNNNNNGC	2 cut(s)	139, 257
NcoI	CCATGG	1 cut(s)	134
NdeII	GATC	6 cut(s)	10, 124, 282, 342, 375, 430
NlaIII	CATG	2 cut(s)	138, 199
NmeAIII	GCCGAG	1 cut(s)	259
PcsI	WCGNNNNNNNCGW	1 cut(s)	231
PkrI	GCNGC	2 cut(s)	322, 445
PstI	CTGCAG	1 cut(s)	403
PsuI	RGATCY	1 cut(s)	282
RsaI	GTAC	3 cut(s)	239, 292, 382
RsaNI	GTAC	3 cut(s)	238, 291, 381
SaqAI	TTAA	2 cut(s)	473, 564
SatI	GCNGC	2 cut(s)	321, 444
Sau3AI	GATC	6 cut(s)	10, 124, 282, 342, 375, 430
ScaI	AGTACT	1 cut(s)	239
SfaNI	GCATC	1 cut(s)	32
SfcI	CTRYAG	1 cut(s)	399
SmlI	CTYRAG	2 cut(s)	143, 563
SmoI	CTYRAG	2 cut(s)	143, 563
Sse9I	AATT	4 cut(s)	103, 204, 474, 509
SsiI	CCGC	5 cut(s)	231, 251, 307, 321, 547
SspMI	CTAG	1 cut(s)	89
StyI	CCWWGG	2 cut(s)	36, 134
TaiI	ACGT	7 cut(s)	96, 228, 292, 300, 336, 396, 468
TaqI	TCGA	1 cut(s)	51
TasI	AATT	4 cut(s)	103, 204, 474, 509
TatI	WGTACW	1 cut(s)	237
TauI	GCSGC	1 cut(s)	323
Tru1I	TTAA	2 cut(s)	473, 564
Tru9I	TTAA	2 cut(s)	473, 564
TseI	GCWGC	1 cut(s)	443
TspDTI	ATGAA	1 cut(s)	180
Vha464I	CTTAAG	1 cut(s)	563
XapI	RAATTY	1 cut(s)	103
XbaI	TCTAGA	1 cut(s)	88
XspI	CTAG	1 cut(s)	89
ZrmI	AGTACT	1 cut(s)	239

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.