Rh2CG099600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0000819
Physical Location & Seq
Forward (+)
8551529 .. 8552904
1376 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG099600.1

Sequence Viewer

Length: 191 bp
ATGGCTGCTGAGTTTATGGTGAAGGACATGCAGTTAATTCGGGCAAAGAACAAATGGGGGACTCTGAGATTTCAAACCACTAACCTCTCTATTTTGATCAGTATCAGAAACTTTCTTTTGGATCAAGGGCTCAAGTGGACTGAAGATTGGTCCTTTGGTACTTGCTGGGAGTTGCACATCAAGAATTCCAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.48

Weight (kDa)

9.03

Isoelectric Point (pI)

24.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 129
AcsI RAATTY 1 cut(s) 184
AcuI CTGAAG 1 cut(s) 162
AfaI GTAC 1 cut(s) 160
AgsI TTSAA 1 cut(s) 74
AlwI GGATC 1 cut(s) 129
ApeKI GCWGC 1 cut(s) 5
ApoI RAATTY 1 cut(s) 184
AspS9I GGNCC 1 cut(s) 150
AsuHPI GGTGA 1 cut(s) 31
AvaII GGWCC 1 cut(s) 150
BanII GRGCYC 1 cut(s) 132
BcgI CGANNNNNNTGC 2 cut(s) 20, 54
BclI TGATCA 1 cut(s) 96
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
Bme18I GGWCC 1 cut(s) 150
BmgT120I GGNCC 1 cut(s) 150
BpuEI CTTGAG 1 cut(s) 116
BsaBI GATNNNNATC 1 cut(s) 101
Bse8I GATNNNNATC 1 cut(s) 101
BseJI GATNNNNATC 1 cut(s) 101
BseMII CTCAG 1 cut(s) 56
BseYI CCCAGC 1 cut(s) 165
BslFI GGGAC 1 cut(s) 73
BsmFI GGGAC 1 cut(s) 73
Bsp1286I GDGCHC 1 cut(s) 132
Bsp143I GATC 2 cut(s) 96, 121
BspCNI CTCAG 1 cut(s) 57
BspPI GGATC 1 cut(s) 129
BssMI GATC 2 cut(s) 96, 121
BstDEI CTNAG 2 cut(s) 9, 65
BstKTI GATC 2 cut(s) 99, 124
BstMBI GATC 2 cut(s) 96, 121
BstNSI RCATGY 1 cut(s) 31
Cfr13I GGNCC 1 cut(s) 150
Csp6I GTAC 1 cut(s) 159
CviAII CATG 1 cut(s) 28
CviJI RGCY 2 cut(s) 5, 130
CviKI_1 RGCY 2 cut(s) 5, 130
CviQI GTAC 1 cut(s) 159
DdeI CTNAG 2 cut(s) 9, 65
DpnI GATC 2 cut(s) 98, 123
DpnII GATC 2 cut(s) 96, 121
Eco24I GRGCYC 1 cut(s) 132
Eco47I GGWCC 1 cut(s) 150
Eco57I CTGAAG 1 cut(s) 162
EcoRI GAATTC 1 cut(s) 184
EcoT38I GRGCYC 1 cut(s) 132
FaeI CATG 1 cut(s) 31
FaiI YATR 2 cut(s) 17, 29
FaqI GGGAC 1 cut(s) 73
FatI CATG 1 cut(s) 27
FbaI TGATCA 1 cut(s) 96
Fnu4HI GCNGC 1 cut(s) 6
FriOI GRGCYC 1 cut(s) 132
Fsp4HI GCNGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 6
GsaI CCCAGC 1 cut(s) 169
Hin1II CATG 1 cut(s) 31
HinfI GANTC 1 cut(s) 61
HphI GGTGA 1 cut(s) 31
Hpy166II GTNNAC 1 cut(s) 138
Hpy188I TCNGA 2 cut(s) 66, 107
Hpy188III TCNNGA 1 cut(s) 181
Hpy8I GTNNAC 1 cut(s) 138
HpyAV CCTTC 1 cut(s) 16
HpyCH4V TGCA 2 cut(s) 31, 175
HpyF3I CTNAG 2 cut(s) 9, 65
Hsp92II CATG 1 cut(s) 31
Ksp22I TGATCA 1 cut(s) 96
Kzo9I GATC 2 cut(s) 96, 121
LpnPI CCDG 1 cut(s) 151
MalI GATC 2 cut(s) 98, 123
MboI GATC 2 cut(s) 96, 121
MboII GAAGA 1 cut(s) 155
MhlI GDGCHC 1 cut(s) 132
MluCI AATT 2 cut(s) 36, 184
MlyI GAGTC 1 cut(s) 55
MnlI CCTC 1 cut(s) 95
MseI TTAA 1 cut(s) 35
NdeII GATC 2 cut(s) 96, 121
NlaIII CATG 1 cut(s) 31
NspI RCATGY 1 cut(s) 31
PkrI GCNGC 1 cut(s) 7
PleI GAGTC 1 cut(s) 55
PpsI GAGTC 1 cut(s) 55
PspFI CCCAGC 1 cut(s) 165
PspPI GGNCC 1 cut(s) 150
RsaI GTAC 1 cut(s) 160
RsaNI GTAC 1 cut(s) 159
SaqAI TTAA 1 cut(s) 35
SatI GCNGC 1 cut(s) 6
Sau3AI GATC 2 cut(s) 96, 121
Sau96I GGNCC 1 cut(s) 150
SchI GAGTC 1 cut(s) 55
SduI GDGCHC 1 cut(s) 132
SetI ASST 1 cut(s) 87
SgeI CNNG 6 cut(s) 40, 53, 137, 145, 174, 178
SinI GGWCC 1 cut(s) 150
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 2 cut(s) 36, 184
TasI AATT 2 cut(s) 36, 184
Tru1I TTAA 1 cut(s) 35
Tru9I TTAA 1 cut(s) 35
TseI GCWGC 1 cut(s) 5
VpaK11BI GGWCC 1 cut(s) 150
XapI RAATTY 1 cut(s) 184
XceI RCATGY 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.