Rh1CG085000

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0000819
Physical Location & Seq
Reverse (-)
17726789 .. 17727422
634 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG085000.1

Sequence Viewer

Length: 279 bp
ATGGTTGATCACTATATTGGCAAAGATCATATTTTCAAACGCAGCAATATTCTGATAAAAGTGTTGTGCTACTATGAGAGTCGTATTCTTGATGCTCATCATGGTTTATTTTCAACATATGCTTTGGAAACATTAGTCCTATATATATTCCATCTTTTTCATTCTTCTCTAGATGGGCCTTTAACGGTCCTCTACAGATTTTTGGATTACTTCAGCAAATTTGATTGGGAGAAATATTCTCTAAAGTACCAGATAATGGAGGGGATGATGTACTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PAP_assoc

Protein Analysis

92

Amino Acids

11.15

Weight (kDa)

6.57

Isoelectric Point (pI)

38.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PAP-OAS1 PF26180 6 - 82 9.8e-42 PAP/OAS1 substrate-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 256
AcsI RAATTY 1 cut(s) 218
AcuI CTGAAG 1 cut(s) 196
AfaI GTAC 2 cut(s) 248, 272
AfiI CCNNNNNNNGG 1 cut(s) 256
AgsI TTSAA 2 cut(s) 37, 114
AoxI GGCC 1 cut(s) 176
ApeKI GCWGC 1 cut(s) 42
ApoI RAATTY 1 cut(s) 218
AspS9I GGNCC 2 cut(s) 176, 187
AvaII GGWCC 1 cut(s) 187
BbvI GCAGC 1 cut(s) 54
BccI CCATC 2 cut(s) 159, 167
BclI TGATCA 1 cut(s) 7
BfaI CTAG 1 cut(s) 170
BfmI CTRYAG 1 cut(s) 193
BisI GCNGC 1 cut(s) 43
BlsI GCNGC 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 187
BmgT120I GGNCC 2 cut(s) 176, 187
BmsI GCATC 1 cut(s) 82
BsaBI GATNNNNATC 1 cut(s) 96
Bsc4I CCNNNNNNNGG 1 cut(s) 256
Bse8I GATNNNNATC 1 cut(s) 96
BseGI GGATG 1 cut(s) 270
BseJI GATNNNNATC 1 cut(s) 96
BseLI CCNNNNNNNGG 1 cut(s) 256
BseXI GCAGC 1 cut(s) 54
BshFI GGCC 1 cut(s) 178
BslI CCNNNNNNNGG 1 cut(s) 256
BsnI GGCC 1 cut(s) 178
Bsp143I GATC 2 cut(s) 7, 25
BspANI GGCC 1 cut(s) 178
BssMI GATC 2 cut(s) 7, 25
Bst4CI ACNGT 1 cut(s) 187
BstF5I GGATG 1 cut(s) 270
BstKTI GATC 2 cut(s) 10, 28
BstMBI GATC 2 cut(s) 7, 25
BstSFI CTRYAG 1 cut(s) 193
BstV1I GCAGC 1 cut(s) 54
BsuRI GGCC 1 cut(s) 178
BtsCI GGATG 1 cut(s) 270
Cfr13I GGNCC 2 cut(s) 176, 187
Csp6I GTAC 2 cut(s) 247, 271
CviAII CATG 1 cut(s) 101
CviJI RGCY 1 cut(s) 178
CviKI_1 RGCY 1 cut(s) 178
CviQI GTAC 2 cut(s) 247, 271
DpnI GATC 2 cut(s) 9, 27
DpnII GATC 2 cut(s) 7, 25
Eco47I GGWCC 1 cut(s) 187
Eco57I CTGAAG 1 cut(s) 196
FaeI CATG 1 cut(s) 104
FaiI YATR 9 cut(s) 15, 30, 75, 102, 118, 120, 142, 144, 146
FatI CATG 1 cut(s) 100
FauNDI CATATG 1 cut(s) 118
FbaI TGATCA 1 cut(s) 7
Fnu4HI GCNGC 1 cut(s) 43
Fsp4HI GCNGC 1 cut(s) 43
FspBI CTAG 1 cut(s) 170
GluI GCNGC 1 cut(s) 43
HaeIII GGCC 1 cut(s) 178
Hin1II CATG 1 cut(s) 104
HinfI GANTC 1 cut(s) 79
Hpy188I TCNGA 1 cut(s) 54
Hpy188III TCNNGA 2 cut(s) 89, 170
HpyCH4III ACNGT 1 cut(s) 187
Hsp92II CATG 1 cut(s) 104
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 2 cut(s) 7, 25
LpnPI CCDG 1 cut(s) 263
Lsp1109I GCAGC 1 cut(s) 54
LweI GCATC 1 cut(s) 82
MaeI CTAG 1 cut(s) 170
MalI GATC 2 cut(s) 9, 27
MboI GATC 2 cut(s) 7, 25
MboII GAAGA 1 cut(s) 156
MluCI AATT 1 cut(s) 218
MlyI GAGTC 1 cut(s) 88
MnlI CCTC 2 cut(s) 200, 253
MseI TTAA 1 cut(s) 182
NdeI CATATG 1 cut(s) 118
NdeII GATC 2 cut(s) 7, 25
NlaIII CATG 1 cut(s) 104
PflMI CCANNNNNTGG 1 cut(s) 256
PkrI GCNGC 1 cut(s) 44
PleI GAGTC 1 cut(s) 87
PpsI GAGTC 1 cut(s) 87
PspPI GGNCC 2 cut(s) 176, 187
RsaI GTAC 2 cut(s) 248, 272
RsaNI GTAC 2 cut(s) 247, 271
SaqAI TTAA 1 cut(s) 182
SatI GCNGC 1 cut(s) 43
Sau3AI GATC 2 cut(s) 7, 25
Sau96I GGNCC 2 cut(s) 176, 187
SchI GAGTC 1 cut(s) 88
SfaNI GCATC 1 cut(s) 82
SfcI CTRYAG 1 cut(s) 193
SgeI CNNG 4 cut(s) 101, 113, 182, 262
SinI GGWCC 1 cut(s) 187
Sse9I AATT 1 cut(s) 218
SspI AATATT 2 cut(s) 49, 236
SspMI CTAG 1 cut(s) 170
TaaI ACNGT 1 cut(s) 187
TasI AATT 1 cut(s) 218
TatI WGTACW 1 cut(s) 270
Tru1I TTAA 1 cut(s) 182
Tru9I TTAA 1 cut(s) 182
TseI GCWGC 1 cut(s) 42
TspDTI ATGAA 1 cut(s) 149
Van91I CCANNNNNTGG 1 cut(s) 256
VpaK11BI GGWCC 1 cut(s) 187
XapI RAATTY 1 cut(s) 218
XbaI TCTAGA 1 cut(s) 169
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.