RLG00000000824

Plant mobile domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0000914
Physical Location & Seq
Forward (+)
5978140 .. 5979949
1810 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000000824

Sequence Viewer

Length: 1050 bp
ATGAAGAGATATAATTGGGCACGAGCTGTTAGAGACTATTTGCTATTGTGTTTGCAAGCTGCTACGAAGGGAAAAGCAAGGCAAATCAGTGGATGTGTAACATTAATCCCGTATTGGATATCCGAGAGGAGTACTATGCTTGTTGAAATTAAAGGCAGAGAAGCAATGACTCCAGGATTGATAATGCAGTTGCCGACAACAATAGAAGCAAACATGGCAAGGAAAACAGCGACGATGACTTTGAGAACCCTCCATCAAAGCATGCTGCTACTGCACAGGCAAAGGGCCAGAAAAGACAGAGAAGAAAAGAAGGCCACAGTAGCTGCCAAAAAACCAGCTAAAAAGCAAGTGGCAGAAAAGAGAGCAAAAAGTAAAGAAAATAAGATCTCGAATGAGGATGCTACTGCACCAGCTGAAAAGGAAAAGCGTAGAAATGAAGAAGAGACAGCTGATAATGAATTAGAAGGTTTCGAAGATGAACATGAAGACATGACATTAAGAGATTGGGTGGATATGAACAGTATGAATTATGTGAAAAAGATGGACGAGAATAAAGGAGAGGAAGAGATGCAAACAAAAGCCACAAGTAGAGTAAATGTCAATGATATGGATTTGGGTGCAACTGAGGAAGAAGAGGATCGGGATGGAACTGAAGGAGAAGAACCGGATCAAATGGAAATGAATGAAAAAGCTGCTACTAAGGCTGATGATGTTGAAAGGAACAAAAAAGCTGCTACTAAGGCTGATGATGTTGAAAGGAACAAAAAAGCTGCTACTGAGGCCGATGCAAATTTTACGGATCAAACCCTGAAAAATATTATAGAAGAGATTGTGAATGAAGCTGCAAGGAGCGAAAAAGCTGCTACTGAGGCCGATGAAGCTGCAAGGAACGACAAAGCTGCTACTGAGGCTGGTGCAAATATTACGGATCAAATCTTCAAAAACATTGTAGAAGAGATTGTGAATGAAGAGTACAAGTGCAGGAATGATCCGGCTTGGTTCAAGGAATGGGAAGACTTGTTGCAGAGTGAGTATGACGAATTTGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1985 PMD

Protein Analysis

350

Amino Acids

39.86

Weight (kDa)

4.94

Isoelectric Point (pI)

50.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 5 cut(s) 645, 675, 807, 936, 983
AcsI RAATTY 2 cut(s) 790, 1040
AcuI CTGAAG 1 cut(s) 672
AfaI GTAC 2 cut(s) 133, 974
AgsI TTSAA 5 cut(s) 146, 716, 755, 940, 1003
AjnI CCWGG 1 cut(s) 172
Alw26I GTCTC 2 cut(s) 27, 437
AlwI GGATC 5 cut(s) 645, 675, 807, 936, 983
AlwNI CAGNNNCTG 1 cut(s) 323
AoxI GGCC 4 cut(s) 285, 312, 780, 870
ApoI RAATTY 2 cut(s) 790, 1040
ArsI GACNNNNNNTTYG 2 cut(s) 223, 255
AseI ATTAAT 1 cut(s) 104
AspS9I GGNCC 1 cut(s) 285
AsuII TTCGAA 1 cut(s) 471
BaeGI GKGCMC 1 cut(s) 22
BauI CACGAG 1 cut(s) 21
BbsI GAAGAC 2 cut(s) 492, 1020
BccI CCATC 3 cut(s) 261, 535, 638
BcgI CGANNNNNNTGC 6 cut(s) 842, 863, 876, 881, 897, 915
BciT130I CCWGG 1 cut(s) 174
BcoDI GTCTC 2 cut(s) 27, 437
BglII AGATCT 1 cut(s) 384
BmcAI AGTACT 1 cut(s) 133
Bme1390I CCNGG 1 cut(s) 174
BmgT120I GGNCC 1 cut(s) 285
BmrFI CCNGG 1 cut(s) 174
BmsI GCATC 3 cut(s) 388, 558, 775
BpiI GAAGAC 2 cut(s) 492, 1020
BpmI CTGGAG 1 cut(s) 156
Bpu14I TTCGAA 1 cut(s) 471
BsaWI WCCGGW 1 cut(s) 664
Bse3DI GCAATG 1 cut(s) 171
BseBI CCWGG 1 cut(s) 174
BseGI GGATG 3 cut(s) 98, 403, 649
BseMI GCAATG 1 cut(s) 171
BseMII CTCAG 4 cut(s) 615, 768, 858, 897
BseRI GAGGAG 1 cut(s) 142
BseSI GKGCMC 1 cut(s) 22
BsgI GTGCAG 3 cut(s) 257, 390, 1000
BshFI GGCC 4 cut(s) 287, 314, 782, 872
BsiSI CCGG 2 cut(s) 665, 992
BsmAI GTCTC 2 cut(s) 27, 437
BsnI GGCC 4 cut(s) 287, 314, 782, 872
Bsp119I TTCGAA 1 cut(s) 471
Bsp1286I GDGCHC 1 cut(s) 22
Bsp143I GATC 6 cut(s) 384, 637, 667, 799, 928, 988
BspANI GGCC 4 cut(s) 287, 314, 782, 872
BspCNI CTCAG 4 cut(s) 616, 769, 859, 898
BspPI GGATC 5 cut(s) 645, 675, 807, 936, 983
BspT104I TTCGAA 1 cut(s) 471
BsrDI GCAATG 1 cut(s) 171
BssMI GATC 6 cut(s) 384, 637, 667, 799, 928, 988
BssSI CACGAG 1 cut(s) 21
Bst2BI CACGAG 1 cut(s) 21
Bst2UI CCWGG 1 cut(s) 174
Bst4CI ACNGT 2 cut(s) 319, 521
Bst6I CTCTTC 6 cut(s) 435, 558, 627, 819, 948, 963
BstBI TTCGAA 1 cut(s) 471
BstC8I GCNNGC 2 cut(s) 57, 263
BstDEI CTNAG 6 cut(s) 624, 699, 738, 777, 867, 906
BstF5I GGATG 3 cut(s) 98, 403, 649
BstKTI GATC 6 cut(s) 387, 640, 670, 802, 931, 991
BstMAI GTCTC 2 cut(s) 27, 437
BstMBI GATC 6 cut(s) 384, 637, 667, 799, 928, 988
BstMWI GCNNNNNNNGC 9 cut(s) 215, 271, 320, 701, 740, 779, 869, 878, 908
BstNI CCWGG 1 cut(s) 174
BstNSI RCATGY 1 cut(s) 265
BstSCI CCNGG 1 cut(s) 172
BstSLI GKGCMC 1 cut(s) 22
BstV2I GAAGAC 2 cut(s) 492, 1020
BstX2I RGATCY 1 cut(s) 384
BstYI RGATCY 1 cut(s) 384
BsuRI GGCC 4 cut(s) 287, 314, 782, 872
BtsCI GGATG 3 cut(s) 98, 403, 649
BtsIMutI CAGTG 1 cut(s) 94
Cac8I GCNNGC 2 cut(s) 57, 263
CaiI CAGNNNCTG 1 cut(s) 323
Cfr13I GGNCC 1 cut(s) 285
Csp6I GTAC 2 cut(s) 132, 973
CviAII CATG 4 cut(s) 214, 262, 482, 490
CviQI GTAC 2 cut(s) 132, 973
DdeI CTNAG 6 cut(s) 624, 699, 738, 777, 867, 906
DpnI GATC 6 cut(s) 386, 639, 669, 801, 930, 990
DpnII GATC 6 cut(s) 384, 637, 667, 799, 928, 988
Eam1104I CTCTTC 6 cut(s) 435, 558, 627, 819, 948, 963
EarI CTCTTC 6 cut(s) 435, 558, 627, 819, 948, 963
Eco32I GATATC 1 cut(s) 120
Eco57I CTGAAG 1 cut(s) 672
EcoRII CCWGG 1 cut(s) 172
EcoRV GATATC 1 cut(s) 120
FaeI CATG 4 cut(s) 217, 265, 485, 493
FatI CATG 4 cut(s) 213, 261, 481, 489
FokI GGATG 3 cut(s) 105, 410, 656
GsuI CTGGAG 1 cut(s) 156
HaeIII GGCC 4 cut(s) 287, 314, 782, 872
HapII CCGG 2 cut(s) 665, 992
Hin1II CATG 4 cut(s) 217, 265, 485, 493
HinfI GANTC 1 cut(s) 169
HpaII CCGG 2 cut(s) 665, 992
Hpy188I TCNGA 1 cut(s) 124
Hpy188III TCNNGA 2 cut(s) 388, 641
Hpy99I CGWCG 1 cut(s) 235
HpyAV CCTTC 4 cut(s) 61, 304, 458, 647
HpyCH4III ACNGT 2 cut(s) 319, 521
HpyF10VI GCNNNNNNNGC 9 cut(s) 215, 271, 320, 701, 740, 779, 869, 878, 908
HpyF3I CTNAG 6 cut(s) 624, 699, 738, 777, 867, 906
Hsp92II CATG 4 cut(s) 217, 265, 485, 493
Kzo9I GATC 6 cut(s) 384, 637, 667, 799, 928, 988
LmnI GCTCC 1 cut(s) 849
LweI GCATC 3 cut(s) 388, 558, 775
MaeIII GTNAC 1 cut(s) 97
MalI GATC 6 cut(s) 386, 639, 669, 801, 930, 990
MboI GATC 6 cut(s) 384, 637, 667, 799, 928, 988
MflI RGATCY 1 cut(s) 384
MhlI GDGCHC 1 cut(s) 22
MluCI AATT 6 cut(s) 13, 147, 458, 526, 790, 1040
MlyI GAGTC 1 cut(s) 163
MnlI CCTC 9 cut(s) 120, 260, 388, 553, 619, 628, 772, 862, 901
MseI TTAA 3 cut(s) 104, 150, 497
MspA1I CMGCKG 2 cut(s) 413, 449
MspI CCGG 2 cut(s) 665, 992
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
MwoI GCNNNNNNNGC 9 cut(s) 215, 271, 320, 701, 740, 779, 869, 878, 908
NdeII GATC 6 cut(s) 384, 637, 667, 799, 928, 988
NlaIII CATG 4 cut(s) 217, 265, 485, 493
NspI RCATGY 1 cut(s) 265
NspV TTCGAA 1 cut(s) 471
PaeI GCATGC 1 cut(s) 265
PfoI TCCNGGA 1 cut(s) 172
PleI GAGTC 1 cut(s) 163
PpsI GAGTC 1 cut(s) 163
PshBI ATTAAT 1 cut(s) 104
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PspPI GGNCC 1 cut(s) 285
PstNI CAGNNNCTG 1 cut(s) 323
PsuI RGATCY 1 cut(s) 384
PvuII CAGCTG 2 cut(s) 413, 449
RsaI GTAC 2 cut(s) 133, 974
RsaNI GTAC 2 cut(s) 132, 973
SaqAI TTAA 3 cut(s) 104, 150, 497
Sau3AI GATC 6 cut(s) 384, 637, 667, 799, 928, 988
Sau96I GGNCC 1 cut(s) 285
ScaI AGTACT 1 cut(s) 133
SchI GAGTC 1 cut(s) 163
ScrFI CCNGG 1 cut(s) 174
SduI GDGCHC 1 cut(s) 22
SfaNI GCATC 3 cut(s) 388, 558, 775
SfuI TTCGAA 1 cut(s) 471
SphI GCATGC 1 cut(s) 265
Sse9I AATT 6 cut(s) 13, 147, 458, 526, 790, 1040
SspI AATATT 2 cut(s) 817, 922
StyD4I CCNGG 1 cut(s) 172
TaaI ACNGT 2 cut(s) 319, 521
TaqI TCGA 2 cut(s) 389, 471
TasI AATT 6 cut(s) 13, 147, 458, 526, 790, 1040
TatI WGTACW 2 cut(s) 131, 972
Tru1I TTAA 3 cut(s) 104, 150, 497
Tru9I TTAA 3 cut(s) 104, 150, 497
TscAI CASTG 1 cut(s) 94
TspGWI ACGGA 2 cut(s) 812, 941
TspRI CASTG 1 cut(s) 94
VspI ATTAAT 1 cut(s) 104
XapI RAATTY 2 cut(s) 790, 1040
XceI RCATGY 1 cut(s) 265
ZrmI AGTACT 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.