RLG00000017720

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Forward (+)
20402453 .. 20404026
1574 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000017720

Sequence Viewer

Length: 309 bp
ATGGAGGTTGGTAAGGTGAGAAGAAAAACTCTGGCATGTAGGAAAAAGTTTCCAAACACAAGAGCAAGATTGAAGAGACAAAAGCAGAAAGAGGTGGAACAAGATAGGGAAGAAGAGGAAAATGAAGAAAAGGAGGAAGAAGATGAAGAAGAACAAGACGGGGGAGAAGAGGATAATGAAGAAGAGGAGGAGGAAGAAGAAGAGAACGATGGAGCAAGGAACAGAGGCAAAGGCCAGAAACAATCATATTGCCAATACAGGTGCAATATGATTGCCTTCCACGACGTGCTTCATAAAGTGTATGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

103

Amino Acids

12.34

Weight (kDa)

4.77

Isoelectric Point (pI)

91.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AdeI CACNNNGTG 1 cut(s) 286
AgsI TTSAA 1 cut(s) 73
AjiI CACGTC 1 cut(s) 286
Alw26I GTCTC 1 cut(s) 70
AoxI GGCC 1 cut(s) 232
AsuHPI GGTGA 1 cut(s) 28
BccI CCATC 1 cut(s) 203
BcoDI GTCTC 1 cut(s) 70
BmgBI CACGTC 1 cut(s) 286
BseRI GAGGAG 2 cut(s) 200, 203
BshFI GGCC 1 cut(s) 234
BsmAI GTCTC 1 cut(s) 70
BsnI GGCC 1 cut(s) 234
BspANI GGCC 1 cut(s) 234
Bst6I CTCTTC 5 cut(s) 68, 108, 162, 177, 195
BstMAI GTCTC 1 cut(s) 70
BstNSI RCATGY 1 cut(s) 39
BsuRI GGCC 1 cut(s) 234
BtrI CACGTC 1 cut(s) 286
CviAII CATG 1 cut(s) 36
CviJI RGCY 1 cut(s) 234
CviKI_1 RGCY 1 cut(s) 234
DraIII CACNNNGTG 1 cut(s) 286
Eam1104I CTCTTC 5 cut(s) 68, 108, 162, 177, 195
EarI CTCTTC 5 cut(s) 68, 108, 162, 177, 195
FaeI CATG 1 cut(s) 39
FaiI YATR 5 cut(s) 37, 247, 269, 294, 303
FatI CATG 1 cut(s) 35
HaeIII GGCC 1 cut(s) 234
Hin1II CATG 1 cut(s) 39
HphI GGTGA 1 cut(s) 28
Hpy99I CGWCG 1 cut(s) 287
HpyAV CCTTC 1 cut(s) 286
HpyCH4IV ACGT 1 cut(s) 285
HpyCH4V TGCA 1 cut(s) 264
HpySE526I ACGT 1 cut(s) 285
Hsp92II CATG 1 cut(s) 39
LmnI GCTCC 1 cut(s) 212
LpnPI CCDG 3 cut(s) 17, 244, 248
MaeII ACGT 1 cut(s) 285
MnlI CCTC 8 cut(s) 85, 109, 127, 163, 178, 181, 184, 218
NlaIII CATG 1 cut(s) 39
NspI RCATGY 1 cut(s) 39
SetI ASST 5 cut(s) 9, 18, 96, 263, 288
TaiI ACGT 1 cut(s) 288
TspDTI ATGAA 4 cut(s) 138, 159, 192, 281
XceI RCATGY 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.