RLG00000001338

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Reverse (-)
14307289 .. 14309109
1821 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000001338

Sequence Viewer

Length: 354 bp
ATGGAGGTTGGTAAGGTGAGAAGAAAAACTCTGGCATGTAGGAAAAAGTTTCCAAGCACAAGAGCAAGATTGAAGAGACAAAAGCAGAAAGAGGTGGAACAAGACAGGGAAGAAGAGGAAAATGAAGAAAAGGAGGAAGAAGATGAAGAAGAACAAGACGGGGGAGAAGAGGATAATGAAGAGGAGGAGGAGGAAGAAGAAGAGAACATGGAGCAAGGAACAGAGGCAAAGCTCAATCGTGAAGAAAAGATGGGATTGAAAGCCGAGTTGAAGAAGACGCCATTTTGGAACTTGATTGAAGCTTATGATAAGGGATTAATGACTAAGACCACAGCTGCATCGAGAGATGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

118

Amino Acids

13.84

Weight (kDa)

4.63

Isoelectric Point (pI)

96.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcyI GRCGYC 1 cut(s) 278
AgsI TTSAA 4 cut(s) 73, 259, 271, 299
AluBI AGCT 3 cut(s) 232, 302, 335
AluI AGCT 3 cut(s) 232, 302, 335
Alw26I GTCTC 1 cut(s) 70
ApeKI GCWGC 1 cut(s) 335
AseI ATTAAT 1 cut(s) 317
AsuHPI GGTGA 1 cut(s) 28
BbsI GAAGAC 1 cut(s) 281
BbvI GCAGC 1 cut(s) 322
BccI CCATC 1 cut(s) 244
BcoDI GTCTC 1 cut(s) 70
BisI GCNGC 1 cut(s) 336
BlsI GCNGC 1 cut(s) 337
BmsI GCATC 2 cut(s) 337, 347
BpiI GAAGAC 1 cut(s) 281
BsaHI GRCGYC 1 cut(s) 278
BseRI GAGGAG 3 cut(s) 197, 200, 203
BseXI GCAGC 1 cut(s) 322
BsmAI GTCTC 1 cut(s) 70
BssNI GRCGYC 1 cut(s) 278
Bst6I CTCTTC 5 cut(s) 68, 108, 162, 174, 195
BstACI GRCGYC 1 cut(s) 278
BstDEI CTNAG 1 cut(s) 324
BstMAI GTCTC 1 cut(s) 70
BstNSI RCATGY 1 cut(s) 39
BstV1I GCAGC 1 cut(s) 322
BstV2I GAAGAC 1 cut(s) 281
CseI GACGC 1 cut(s) 286
CviAII CATG 2 cut(s) 36, 208
CviJI RGCY 4 cut(s) 232, 263, 302, 335
CviKI_1 RGCY 4 cut(s) 232, 263, 302, 335
DdeI CTNAG 1 cut(s) 324
Eam1104I CTCTTC 5 cut(s) 68, 108, 162, 174, 195
EarI CTCTTC 5 cut(s) 68, 108, 162, 174, 195
EcoT22I ATGCAT 1 cut(s) 352
FaeI CATG 2 cut(s) 39, 211
FaiI YATR 4 cut(s) 37, 209, 306, 352
FatI CATG 2 cut(s) 35, 207
Fnu4HI GCNGC 1 cut(s) 336
Fsp4HI GCNGC 1 cut(s) 336
GluI GCNGC 1 cut(s) 336
HgaI GACGC 1 cut(s) 286
Hin1I GRCGYC 1 cut(s) 278
Hin1II CATG 2 cut(s) 39, 211
HindIII AAGCTT 1 cut(s) 300
HphI GGTGA 1 cut(s) 28
Hpy188III TCNNGA 2 cut(s) 239, 342
HpyCH4V TGCA 2 cut(s) 338, 350
HpyF3I CTNAG 1 cut(s) 324
Hsp92I GRCGYC 1 cut(s) 278
Hsp92II CATG 2 cut(s) 39, 211
LmnI GCTCC 1 cut(s) 211
LpnPI CCDG 2 cut(s) 17, 91
Lsp1109I GCAGC 1 cut(s) 322
LweI GCATC 2 cut(s) 337, 347
MnlI CCTC 9 cut(s) 85, 109, 127, 163, 175, 178, 181, 184, 217
Mph1103I ATGCAT 1 cut(s) 352
MseI TTAA 1 cut(s) 317
MspA1I CMGCKG 1 cut(s) 335
NlaIII CATG 2 cut(s) 39, 211
NmeAIII GCCGAG 1 cut(s) 289
NsiI ATGCAT 1 cut(s) 352
NspI RCATGY 1 cut(s) 39
PkrI GCNGC 1 cut(s) 337
PshBI ATTAAT 1 cut(s) 317
PvuII CAGCTG 1 cut(s) 335
SaqAI TTAA 1 cut(s) 317
SatI GCNGC 1 cut(s) 336
SetI ASST 6 cut(s) 9, 18, 96, 234, 304, 337
SfaNI GCATC 2 cut(s) 337, 347
TaqI TCGA 1 cut(s) 341
Tru1I TTAA 1 cut(s) 317
Tru9I TTAA 1 cut(s) 317
TseI GCWGC 1 cut(s) 335
TspDTI ATGAA 3 cut(s) 138, 159, 192
VspI ATTAAT 1 cut(s) 317
XceI RCATGY 1 cut(s) 39
Zsp2I ATGCAT 1 cut(s) 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.