RLG00000031694

Plant mobile domain

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr7
Physical Location & Seq
Forward (+)
7466660 .. 7468337
1678 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000031694

Sequence Viewer

Length: 615 bp
ATGGAGGTTGGTAAGGTGAGAAGAAAAACTCTGGCATGTAGGAAAAAGTTTCCAAGCACAAGATCAAGATTGAAGAGACAAAAGCAGAAAGAGGTGGAACAAGACAAGGAAGAAGAGGAAAATGAAGAAAAGGAAGAAGAAGATGAAGAAGAACAAGACAGGGGAGAAGGGGATAATGAAGAAGAGGAGGAGGAAGAAGAAGAGAACGATGGAGCAAGGAACAGAGGCAAAGGCCAGAAACAATCATATTGCCAATATAGGTGCAATATGATTGCCTTCCACGACGTGCTTCATAAAGCGTATGAGCAGCTCAATCGTGAAGAAAAGATGGGATTAAAAGCCGAGTTGAAGAAGATGCCATTTTGGAACTTGATTGAAGCTTATGATAAGGGATTGATGACTAAGAACACATCTGCAAAATCAGATCGAGAGATGCATAGGTTAGTGCAATGCTACAAGCTGGCTTTGAAGAAATTTAAGTTTGGAAACAAGTTGGCAGAAATAAGTGTATCGGACGTGCAATACATTTTGGGTTTGCCAAACCGAAAATCAGCTATTACGGTGCCAAACCCAATAGATGATCCTAAGAAGCCGACTGATCATCCTCTTGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

205

Amino Acids

23.99

Weight (kDa)

5.97

Isoelectric Point (pI)

66.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 562
AclWI GGATC 1 cut(s) 575
AcsI RAATTY 1 cut(s) 473
AdeI CACNNNGTG 1 cut(s) 286
AgsI TTSAA 4 cut(s) 73, 349, 377, 469
AjiI CACGTC 2 cut(s) 286, 517
AluBI AGCT 4 cut(s) 310, 380, 460, 554
AluI AGCT 4 cut(s) 310, 380, 460, 554
Alw26I GTCTC 1 cut(s) 70
AlwI GGATC 1 cut(s) 575
AoxI GGCC 1 cut(s) 232
ApeKI GCWGC 1 cut(s) 307
ApoI RAATTY 1 cut(s) 473
AsuHPI GGTGA 1 cut(s) 28
BanI GGYRCC 1 cut(s) 562
BbvI GCAGC 1 cut(s) 319
BccI CCATC 2 cut(s) 203, 322
BcgI CGANNNNNNTGC 2 cut(s) 296, 330
BclI TGATCA 1 cut(s) 598
BcoDI GTCTC 1 cut(s) 70
BisI GCNGC 1 cut(s) 308
BlsI GCNGC 1 cut(s) 309
BmgBI CACGTC 2 cut(s) 286, 517
BmiI GGNNCC 1 cut(s) 564
BmsI GCATC 2 cut(s) 345, 423
Bse3DI GCAATG 1 cut(s) 455
BseGI GGATG 1 cut(s) 601
BseMI GCAATG 1 cut(s) 455
BseRI GAGGAG 2 cut(s) 200, 203
BseXI GCAGC 1 cut(s) 319
BshFI GGCC 1 cut(s) 234
BshNI GGYRCC 1 cut(s) 562
BsmAI GTCTC 1 cut(s) 70
BsnI GGCC 1 cut(s) 234
Bsp143I GATC 4 cut(s) 62, 424, 580, 598
BspANI GGCC 1 cut(s) 234
BspLI GGNNCC 1 cut(s) 564
BspPI GGATC 1 cut(s) 575
BspT107I GGYRCC 1 cut(s) 562
BsrDI GCAATG 1 cut(s) 455
BssMI GATC 4 cut(s) 62, 424, 580, 598
Bst4CI ACNGT 1 cut(s) 562
Bst6I CTCTTC 4 cut(s) 68, 108, 177, 195
BstC8I GCNNGC 1 cut(s) 462
BstDEI CTNAG 2 cut(s) 402, 585
BstF5I GGATG 1 cut(s) 601
BstKTI GATC 4 cut(s) 65, 427, 583, 601
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 4 cut(s) 62, 424, 580, 598
BstNSI RCATGY 1 cut(s) 39
BstV1I GCAGC 1 cut(s) 319
BsuRI GGCC 1 cut(s) 234
BtrI CACGTC 2 cut(s) 286, 517
BtsCI GGATG 1 cut(s) 601
Cac8I GCNNGC 1 cut(s) 462
CviAII CATG 1 cut(s) 36
CviJI RGCY 8 cut(s) 234, 310, 341, 380, 460, 464, 554, 592
CviKI_1 RGCY 8 cut(s) 234, 310, 341, 380, 460, 464, 554, 592
DdeI CTNAG 2 cut(s) 402, 585
DpnI GATC 4 cut(s) 64, 426, 582, 600
DpnII GATC 4 cut(s) 62, 424, 580, 598
DraIII CACNNNGTG 1 cut(s) 286
Eam1104I CTCTTC 4 cut(s) 68, 108, 177, 195
EarI CTCTTC 4 cut(s) 68, 108, 177, 195
EcoT22I ATGCAT 1 cut(s) 438
FaeI CATG 1 cut(s) 39
FaiI YATR 8 cut(s) 37, 247, 258, 269, 294, 303, 384, 438
FatI CATG 1 cut(s) 35
FbaI TGATCA 1 cut(s) 598
Fnu4HI GCNGC 1 cut(s) 308
FokI GGATG 1 cut(s) 588
Fsp4HI GCNGC 1 cut(s) 308
GluI GCNGC 1 cut(s) 308
HaeIII GGCC 1 cut(s) 234
Hin1II CATG 1 cut(s) 39
HindIII AAGCTT 1 cut(s) 378
HphI GGTGA 1 cut(s) 28
Hpy188I TCNGA 2 cut(s) 424, 514
Hpy188III TCNNGA 3 cut(s) 66, 317, 428
Hpy99I CGWCG 1 cut(s) 287
HpyAV CCTTC 2 cut(s) 161, 286
HpyCH4III ACNGT 1 cut(s) 562
HpyCH4IV ACGT 2 cut(s) 285, 516
HpyCH4V TGCA 5 cut(s) 264, 416, 436, 448, 520
HpyF3I CTNAG 2 cut(s) 402, 585
HpySE526I ACGT 2 cut(s) 285, 516
Hsp92II CATG 1 cut(s) 39
Ksp22I TGATCA 1 cut(s) 598
Kzo9I GATC 4 cut(s) 62, 424, 580, 598
LmnI GCTCC 1 cut(s) 212
LpnPI CCDG 4 cut(s) 17, 145, 248, 446
Lsp1109I GCAGC 1 cut(s) 319
LweI GCATC 2 cut(s) 345, 423
MaeII ACGT 2 cut(s) 285, 516
MalI GATC 4 cut(s) 64, 426, 582, 600
MboI GATC 4 cut(s) 62, 424, 580, 598
MluCI AATT 1 cut(s) 473
MnlI CCTC 7 cut(s) 85, 109, 178, 181, 184, 218, 615
Mph1103I ATGCAT 1 cut(s) 438
MseI TTAA 2 cut(s) 335, 477
NdeII GATC 4 cut(s) 62, 424, 580, 598
NlaIII CATG 1 cut(s) 39
NlaIV GGNNCC 1 cut(s) 564
NmeAIII GCCGAG 1 cut(s) 367
NsiI ATGCAT 1 cut(s) 438
NspI RCATGY 1 cut(s) 39
PkrI GCNGC 1 cut(s) 309
PspN4I GGNNCC 1 cut(s) 564
SaqAI TTAA 2 cut(s) 335, 477
SatI GCNGC 1 cut(s) 308
Sau3AI GATC 4 cut(s) 62, 424, 580, 598
SfaNI GCATC 2 cut(s) 345, 423
Sse9I AATT 1 cut(s) 473
TaaI ACNGT 1 cut(s) 562
TaiI ACGT 2 cut(s) 288, 519
TaqI TCGA 1 cut(s) 427
TasI AATT 1 cut(s) 473
Tru1I TTAA 2 cut(s) 335, 477
Tru9I TTAA 2 cut(s) 335, 477
TseI GCWGC 1 cut(s) 307
TspDTI ATGAA 4 cut(s) 138, 159, 192, 281
XapI RAATTY 1 cut(s) 473
XceI RCATGY 1 cut(s) 39
Zsp2I ATGCAT 1 cut(s) 438
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.