RLG00000012957
MYB Family

Transcription factor

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Reverse (-)
24300461 .. 24300841
381 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000012957

Sequence Viewer

Length: 381 bp
ATGGCGGGAAGTGCTATCGAGAGCTGCAAGAGGAAGCAAGCTTATATAGAGAGATTGTGGGATGAAAAAGAAGAAGTGTTAAAAAAATACAAAAAGTTGAAGACAAAGATGAAGAAGAAGCAAGAAGAGATTAGAAAATGGAGAAACAAATGCAAACAACTAATGATGATAGTGCAAAGGATAGAAAAAGATGAAGAGGCCAATGAAGATGCTGCTGCTGCTCCTCCTGCTGTTCCTGCTCATGCTACTGCTCCTACAAATGAACCGAGGACACGATCAGCGATAAAGAGAATCAAAGAAAGAACCGATCGGAAAGAGAAGCAACTAGAAGGTTTTGAGGTGCAGAAACCATCAAAGAAACAGAGGAAGAAGAGCAATTAA

Protein Analysis

127

Amino Acids

14.85

Weight (kDa)

9.97

Isoelectric Point (pI)

67.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AgsI TTSAA 1 cut(s) 100
AluBI AGCT 2 cut(s) 24, 41
AluI AGCT 2 cut(s) 24, 41
AoxI GGCC 1 cut(s) 198
ApeKI GCWGC 4 cut(s) 24, 212, 215, 218
BbsI GAAGAC 1 cut(s) 107
BbvI GCAGC 4 cut(s) 11, 199, 202, 205
BccI CCATC 1 cut(s) 358
BfaI CTAG 1 cut(s) 326
BisI GCNGC 4 cut(s) 25, 213, 216, 219
BlsI GCNGC 4 cut(s) 26, 214, 217, 220
BmsI GCATC 1 cut(s) 199
BpiI GAAGAC 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 266
BseDI CCNNGG 1 cut(s) 266
BseGI GGATG 1 cut(s) 67
BseRI GAGGAG 1 cut(s) 213
BseXI GCAGC 4 cut(s) 11, 199, 202, 205
BsgI GTGCAG 1 cut(s) 362
Bsh1285I CGRYCG 1 cut(s) 310
BshFI GGCC 1 cut(s) 200
BsiEI CGRYCG 1 cut(s) 310
BsnI GGCC 1 cut(s) 200
Bsp143I GATC 2 cut(s) 275, 307
BspACI CCGC 1 cut(s) 5
BspANI GGCC 1 cut(s) 200
BspQI GCTCTTC 1 cut(s) 365
BssECI CCNNGG 1 cut(s) 266
BssMI GATC 2 cut(s) 275, 307
Bst6I CTCTTC 3 cut(s) 120, 189, 365
BstC8I GCNNGC 1 cut(s) 39
BstF5I GGATG 1 cut(s) 67
BstKTI GATC 2 cut(s) 278, 310
BstMBI GATC 2 cut(s) 275, 307
BstMCI CGRYCG 1 cut(s) 310
BstMWI GCNNNNNNNGC 4 cut(s) 11, 218, 227, 236
BstV1I GCAGC 4 cut(s) 11, 199, 202, 205
BstV2I GAAGAC 1 cut(s) 107
BsuRI GGCC 1 cut(s) 200
BtsCI GGATG 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 39
CviAII CATG 1 cut(s) 242
CviJI RGCY 3 cut(s) 24, 41, 200
CviKI_1 RGCY 3 cut(s) 24, 41, 200
DpnI GATC 2 cut(s) 277, 309
DpnII GATC 2 cut(s) 275, 307
Eam1104I CTCTTC 3 cut(s) 120, 189, 365
EarI CTCTTC 3 cut(s) 120, 189, 365
FaeI CATG 1 cut(s) 245
FaiI YATR 3 cut(s) 45, 47, 243
FatI CATG 1 cut(s) 241
Fnu4HI GCNGC 4 cut(s) 25, 213, 216, 219
FokI GGATG 1 cut(s) 74
Fsp4HI GCNGC 4 cut(s) 25, 213, 216, 219
FspBI CTAG 1 cut(s) 326
GluI GCNGC 4 cut(s) 25, 213, 216, 219
HaeIII GGCC 1 cut(s) 200
Hin1II CATG 1 cut(s) 245
HindIII AAGCTT 1 cut(s) 39
HinfI GANTC 1 cut(s) 291
Hpy188I TCNGA 1 cut(s) 312
Hpy188III TCNNGA 1 cut(s) 19
HpyAV CCTTC 1 cut(s) 323
HpyCH4V TGCA 4 cut(s) 27, 153, 175, 343
HpyF10VI GCNNNNNNNGC 4 cut(s) 11, 218, 227, 236
Hsp92II CATG 1 cut(s) 245
Kzo9I GATC 2 cut(s) 275, 307
LguI GCTCTTC 1 cut(s) 365
LmnI GCTCC 2 cut(s) 226, 256
LpnPI CCDG 2 cut(s) 240, 249
Lsp1109I GCAGC 4 cut(s) 11, 199, 202, 205
LweI GCATC 1 cut(s) 199
MaeI CTAG 1 cut(s) 326
MalI GATC 2 cut(s) 277, 309
MboI GATC 2 cut(s) 275, 307
MboII GAAGA 8 cut(s) 83, 112, 124, 127, 137, 206, 218, 379
MluCI AATT 1 cut(s) 376
MnlI CCTC 6 cut(s) 24, 190, 234, 261, 331, 357
MseI TTAA 2 cut(s) 80, 379
MwoI GCNNNNNNNGC 4 cut(s) 11, 218, 227, 236
NdeII GATC 2 cut(s) 275, 307
NlaIII CATG 1 cut(s) 245
PciSI GCTCTTC 1 cut(s) 365
PfeI GAWTC 1 cut(s) 291
PkrI GCNGC 4 cut(s) 26, 214, 217, 220
Ple19I CGATCG 1 cut(s) 310
PvuI CGATCG 1 cut(s) 310
SapI GCTCTTC 1 cut(s) 365
SaqAI TTAA 2 cut(s) 80, 379
SatI GCNGC 4 cut(s) 25, 213, 216, 219
Sau3AI GATC 2 cut(s) 275, 307
SetI ASST 4 cut(s) 26, 43, 334, 342
SfaNI GCATC 1 cut(s) 199
Sse9I AATT 1 cut(s) 376
SsiI CCGC 1 cut(s) 5
SspMI CTAG 1 cut(s) 326
TaqI TCGA 1 cut(s) 18
TasI AATT 1 cut(s) 376
TfiI GAWTC 1 cut(s) 291
Tru1I TTAA 2 cut(s) 80, 379
Tru9I TTAA 2 cut(s) 80, 379
TseI GCWGC 4 cut(s) 24, 212, 215, 218
TspDTI ATGAA 5 cut(s) 78, 125, 207, 219, 276
XspI CTAG 1 cut(s) 326
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.